Incidental Mutation 'R2044:Pdzk1'
ID221600
Institutional Source Beutler Lab
Gene Symbol Pdzk1
Ensembl Gene ENSMUSG00000038298
Gene NamePDZ domain containing 1
SynonymsmPDZK1, 1700023D20Rik, D3Ertd537e, 4921513F16Rik, 2610507N21Rik
MMRRC Submission 040051-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R2044 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96829284-96870926 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 96855848 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058865] [ENSMUST00000107069] [ENSMUST00000107070] [ENSMUST00000135031] [ENSMUST00000138014] [ENSMUST00000153256]
Predicted Effect probably benign
Transcript: ENSMUST00000058865
SMART Domains Protein: ENSMUSP00000058936
Gene: ENSMUSG00000038298

DomainStartEndE-ValueType
PDZ 18 90 2.41e-17 SMART
PDZ 143 215 1e-14 SMART
PDZ 251 323 2.81e-18 SMART
PDZ 386 458 4.5e-17 SMART
low complexity region 505 514 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107069
SMART Domains Protein: ENSMUSP00000102684
Gene: ENSMUSG00000038298

DomainStartEndE-ValueType
PDZ 18 90 2.41e-17 SMART
PDZ 143 215 1e-14 SMART
PDZ 251 323 2.81e-18 SMART
PDZ 386 458 4.5e-17 SMART
low complexity region 505 514 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107070
SMART Domains Protein: ENSMUSP00000102685
Gene: ENSMUSG00000038298

DomainStartEndE-ValueType
PDZ 18 90 2.41e-17 SMART
PDZ 143 215 1e-14 SMART
PDZ 251 323 2.81e-18 SMART
PDZ 386 458 4.5e-17 SMART
low complexity region 505 514 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135031
SMART Domains Protein: ENSMUSP00000114157
Gene: ENSMUSG00000038298

DomainStartEndE-ValueType
PDZ 18 90 2.41e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138014
SMART Domains Protein: ENSMUSP00000115584
Gene: ENSMUSG00000038298

DomainStartEndE-ValueType
PDZ 18 90 2.41e-17 SMART
PDB:2EEI|A 125 153 2e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000153256
SMART Domains Protein: ENSMUSP00000118846
Gene: ENSMUSG00000038298

DomainStartEndE-ValueType
PDZ 18 90 2.41e-17 SMART
PDZ 143 215 1e-14 SMART
PDZ 251 323 2.81e-18 SMART
PDZ 386 458 4.5e-17 SMART
low complexity region 505 514 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ domain-containing scaffolding protein. PDZ domain-containing molecules bind to and mediate the subcellular localization of target proteins. The encoded protein mediates the localization of cell surface proteins and plays a critical role in cholesterol metabolism by regulating the HDL receptor, scavenger receptor class B type 1. Single nucleotide polymorphisms in this gene may be associated with metabolic syndrome, and overexpression of this gene may play a role in drug resistance of multiple myeloma. Pseudogenes of this gene are located on the long arm of chromosome 1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this gene results in increased serum cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 36,978,094 probably benign Het
Abhd15 A G 11: 77,518,338 T293A probably benign Het
Aldh1l1 C T 6: 90,562,665 P192L probably benign Het
Aldoart1 T G 4: 72,852,542 I10L probably benign Het
Ankhd1 G A 18: 36,645,113 G1653D probably benign Het
Ankk1 A C 9: 49,419,364 probably null Het
Astn1 A G 1: 158,600,502 T748A possibly damaging Het
Bmp7 C A 2: 172,939,915 R52L possibly damaging Het
Ccdc151 T G 9: 21,991,858 T419P possibly damaging Het
Ccdc33 G A 9: 58,031,112 P859S possibly damaging Het
Ccny A G 18: 9,449,644 S10P probably damaging Het
Cdc6 C A 11: 98,910,461 F179L probably benign Het
Cdc7 T A 5: 106,983,132 V491E probably benign Het
Cdh23 G T 10: 60,596,730 S138R possibly damaging Het
Cenpc1 T C 5: 86,037,755 H299R probably benign Het
Ciart A T 3: 95,878,701 M354K probably benign Het
Clasrp G T 7: 19,586,715 probably benign Het
Col4a3 G A 1: 82,696,319 G1132E unknown Het
Crebbp G A 16: 4,084,823 T2184I probably benign Het
Cyp2r1 A C 7: 114,550,405 M458R probably damaging Het
Cyp7a1 C A 4: 6,275,492 R27M probably null Het
Ddhd2 A G 8: 25,752,165 F116L probably damaging Het
Dgkd G A 1: 87,927,691 R685K probably benign Het
Dnah2 A G 11: 69,524,240 S223P probably benign Het
Exph5 A T 9: 53,372,679 R353S possibly damaging Het
F11 C A 8: 45,252,118 V129F probably benign Het
F830045P16Rik A T 2: 129,459,397 S454T possibly damaging Het
Fam124a T C 14: 62,587,207 I50T probably damaging Het
Fam20c T C 5: 138,756,227 probably null Het
Fam234b A G 6: 135,226,914 T405A probably benign Het
Fbxo18 C A 2: 11,762,970 V356L possibly damaging Het
Flywch1 G A 17: 23,762,313 Q132* probably null Het
Foxo6 T C 4: 120,286,969 D95G probably benign Het
Ggt5 T C 10: 75,604,087 F174S probably damaging Het
Gm7104 G A 12: 88,285,781 noncoding transcript Het
Gpr155 A G 2: 73,373,633 L279P probably damaging Het
H2-T23 A G 17: 36,032,191 L98P probably damaging Het
Heatr5a A G 12: 51,955,403 V250A probably benign Het
Heyl A T 4: 123,241,363 I50F probably damaging Het
Hist4h4 G C 6: 136,804,103 R93G possibly damaging Het
Ifitm10 A T 7: 142,356,034 S179R probably damaging Het
Isg15 A T 4: 156,199,792 I93N probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itga10 G A 3: 96,657,690 V985I probably benign Het
Kcnt2 T C 1: 140,375,154 I144T probably benign Het
Klk1 A C 7: 44,229,034 K104T possibly damaging Het
Lemd3 C A 10: 120,933,442 R654L probably damaging Het
Lmod1 A T 1: 135,364,387 M327L probably benign Het
Lonrf2 T C 1: 38,807,050 E347G probably benign Het
Ltbp1 A G 17: 75,276,432 Y409C probably damaging Het
Mecom A T 3: 29,980,592 Y312N probably damaging Het
Mrgprb3 C T 7: 48,643,734 C23Y possibly damaging Het
Mut A G 17: 40,941,451 T295A probably benign Het
Nadk C A 4: 155,585,441 L194I probably damaging Het
Naxd A G 8: 11,509,510 I182V probably benign Het
Nbeal1 T A 1: 60,319,687 I1176K probably damaging Het
Nol4l C A 2: 153,529,521 R81L possibly damaging Het
Olfr1297 T A 2: 111,621,814 R87W probably benign Het
Olfr1411 G T 1: 92,596,969 R150L probably benign Het
Olfr957 A T 9: 39,511,378 M114K probably damaging Het
Pcdh18 A G 3: 49,754,940 V642A probably benign Het
Per3 C T 4: 151,033,938 V233I probably benign Het
Pisd G A 5: 32,764,796 P267S possibly damaging Het
Prm1 T A 16: 10,796,493 probably benign Het
Ptprj A G 2: 90,463,095 V548A probably damaging Het
Ranbp3 G A 17: 56,673,367 probably benign Het
Raver2 T A 4: 101,102,812 V163D probably damaging Het
Rbm14 A T 19: 4,803,877 I159N possibly damaging Het
Rfx6 G A 10: 51,718,126 V381I probably benign Het
Rhobtb1 T C 10: 69,272,863 probably benign Het
Rpl28-ps4 T A 6: 117,213,895 noncoding transcript Het
Rsph10b A G 5: 143,967,250 probably null Het
Rspo4 A G 2: 151,873,093 K217E unknown Het
Scgb2b27 G A 7: 34,013,285 A44V possibly damaging Het
Sec14l2 G A 11: 4,111,435 probably benign Het
Sec31b T C 19: 44,536,156 N101D probably benign Het
Sema6a A T 18: 47,306,429 C9* probably null Het
Sept5 A C 16: 18,623,012 L331R probably benign Het
Slc16a11 C A 11: 70,215,651 Y238* probably null Het
Slc25a12 T C 2: 71,312,548 T210A probably benign Het
Slc35f1 A T 10: 53,089,347 Y286F probably damaging Het
Szt2 A T 4: 118,376,448 L2225* probably null Het
Thap12 T C 7: 98,716,620 L665P probably damaging Het
Tpsb2 T A 17: 25,367,724 W237R probably damaging Het
Tyk2 T C 9: 21,120,341 D451G probably damaging Het
Ube2j1 T A 4: 33,049,696 N231K probably benign Het
Vmn1r225 A T 17: 20,502,590 T98S possibly damaging Het
Vmn1r87 A T 7: 13,131,821 S180T probably benign Het
Vmn2r6 A G 3: 64,537,841 V821A probably damaging Het
Zfp689 C A 7: 127,444,826 G211C probably damaging Het
Zfp827 A G 8: 79,076,236 D479G probably benign Het
Zfp995 A C 17: 21,880,594 F220V probably damaging Het
Other mutations in Pdzk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Pdzk1 APN 3 96868426 missense probably benign
IGL01895:Pdzk1 APN 3 96869101 missense possibly damaging 0.96
IGL01995:Pdzk1 APN 3 96857371 missense probably benign 0.01
IGL02027:Pdzk1 APN 3 96854673 splice site probably benign
R1762:Pdzk1 UTSW 3 96851573 missense probably benign 0.01
R4721:Pdzk1 UTSW 3 96869202 nonsense probably null
R4831:Pdzk1 UTSW 3 96868435 missense probably benign
R5070:Pdzk1 UTSW 3 96850321 missense probably benign 0.05
R6020:Pdzk1 UTSW 3 96868426 missense probably benign
R6049:Pdzk1 UTSW 3 96851663 missense probably benign 0.00
R6816:Pdzk1 UTSW 3 96854570 missense probably benign 0.13
R7065:Pdzk1 UTSW 3 96868432 missense probably benign
R7134:Pdzk1 UTSW 3 96855930 missense probably benign 0.16
R7779:Pdzk1 UTSW 3 96857273 missense probably damaging 1.00
Z1088:Pdzk1 UTSW 3 96854557 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGGCTCCCACTTGAGTTC -3'
(R):5'- TTGGTGAGCCAGAGACTAGG -3'

Sequencing Primer
(F):5'- AGGCTCCCACTTGAGTTCAGTTAC -3'
(R):5'- TCAGATAGAAGCCATAGCCATTG -3'
Posted On2014-08-25