Incidental Mutation 'R2044:Szt2'
ID221610
Institutional Source Beutler Lab
Gene Symbol Szt2
Ensembl Gene ENSMUSG00000033253
Gene Nameseizure threshold 2
Synonyms
MMRRC Submission 040051-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.809) question?
Stock #R2044 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location118362743-118409273 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 118376448 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 2225 (L2225*)
Ref Sequence ENSEMBL: ENSMUSP00000074862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075406]
Predicted Effect probably null
Transcript: ENSMUST00000075406
AA Change: L2225*
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: L2225*

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138386
Predicted Effect probably benign
Transcript: ENSMUST00000183402
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 36,978,094 probably benign Het
Abhd15 A G 11: 77,518,338 T293A probably benign Het
Aldh1l1 C T 6: 90,562,665 P192L probably benign Het
Aldoart1 T G 4: 72,852,542 I10L probably benign Het
Ankhd1 G A 18: 36,645,113 G1653D probably benign Het
Ankk1 A C 9: 49,419,364 probably null Het
Astn1 A G 1: 158,600,502 T748A possibly damaging Het
Bmp7 C A 2: 172,939,915 R52L possibly damaging Het
Ccdc151 T G 9: 21,991,858 T419P possibly damaging Het
Ccdc33 G A 9: 58,031,112 P859S possibly damaging Het
Ccny A G 18: 9,449,644 S10P probably damaging Het
Cdc6 C A 11: 98,910,461 F179L probably benign Het
Cdc7 T A 5: 106,983,132 V491E probably benign Het
Cdh23 G T 10: 60,596,730 S138R possibly damaging Het
Cenpc1 T C 5: 86,037,755 H299R probably benign Het
Ciart A T 3: 95,878,701 M354K probably benign Het
Clasrp G T 7: 19,586,715 probably benign Het
Col4a3 G A 1: 82,696,319 G1132E unknown Het
Crebbp G A 16: 4,084,823 T2184I probably benign Het
Cyp2r1 A C 7: 114,550,405 M458R probably damaging Het
Cyp7a1 C A 4: 6,275,492 R27M probably null Het
Ddhd2 A G 8: 25,752,165 F116L probably damaging Het
Dgkd G A 1: 87,927,691 R685K probably benign Het
Dnah2 A G 11: 69,524,240 S223P probably benign Het
Exph5 A T 9: 53,372,679 R353S possibly damaging Het
F11 C A 8: 45,252,118 V129F probably benign Het
F830045P16Rik A T 2: 129,459,397 S454T possibly damaging Het
Fam124a T C 14: 62,587,207 I50T probably damaging Het
Fam20c T C 5: 138,756,227 probably null Het
Fam234b A G 6: 135,226,914 T405A probably benign Het
Fbxo18 C A 2: 11,762,970 V356L possibly damaging Het
Flywch1 G A 17: 23,762,313 Q132* probably null Het
Foxo6 T C 4: 120,286,969 D95G probably benign Het
Ggt5 T C 10: 75,604,087 F174S probably damaging Het
Gm7104 G A 12: 88,285,781 noncoding transcript Het
Gpr155 A G 2: 73,373,633 L279P probably damaging Het
H2-T23 A G 17: 36,032,191 L98P probably damaging Het
Heatr5a A G 12: 51,955,403 V250A probably benign Het
Heyl A T 4: 123,241,363 I50F probably damaging Het
Hist4h4 G C 6: 136,804,103 R93G possibly damaging Het
Ifitm10 A T 7: 142,356,034 S179R probably damaging Het
Isg15 A T 4: 156,199,792 I93N probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itga10 G A 3: 96,657,690 V985I probably benign Het
Kcnt2 T C 1: 140,375,154 I144T probably benign Het
Klk1 A C 7: 44,229,034 K104T possibly damaging Het
Lemd3 C A 10: 120,933,442 R654L probably damaging Het
Lmod1 A T 1: 135,364,387 M327L probably benign Het
Lonrf2 T C 1: 38,807,050 E347G probably benign Het
Ltbp1 A G 17: 75,276,432 Y409C probably damaging Het
Mecom A T 3: 29,980,592 Y312N probably damaging Het
Mrgprb3 C T 7: 48,643,734 C23Y possibly damaging Het
Mut A G 17: 40,941,451 T295A probably benign Het
Nadk C A 4: 155,585,441 L194I probably damaging Het
Naxd A G 8: 11,509,510 I182V probably benign Het
Nbeal1 T A 1: 60,319,687 I1176K probably damaging Het
Nol4l C A 2: 153,529,521 R81L possibly damaging Het
Olfr1297 T A 2: 111,621,814 R87W probably benign Het
Olfr1411 G T 1: 92,596,969 R150L probably benign Het
Olfr957 A T 9: 39,511,378 M114K probably damaging Het
Pcdh18 A G 3: 49,754,940 V642A probably benign Het
Pdzk1 G A 3: 96,855,848 probably benign Het
Per3 C T 4: 151,033,938 V233I probably benign Het
Pisd G A 5: 32,764,796 P267S possibly damaging Het
Prm1 T A 16: 10,796,493 probably benign Het
Ptprj A G 2: 90,463,095 V548A probably damaging Het
Ranbp3 G A 17: 56,673,367 probably benign Het
Raver2 T A 4: 101,102,812 V163D probably damaging Het
Rbm14 A T 19: 4,803,877 I159N possibly damaging Het
Rfx6 G A 10: 51,718,126 V381I probably benign Het
Rhobtb1 T C 10: 69,272,863 probably benign Het
Rpl28-ps4 T A 6: 117,213,895 noncoding transcript Het
Rsph10b A G 5: 143,967,250 probably null Het
Rspo4 A G 2: 151,873,093 K217E unknown Het
Scgb2b27 G A 7: 34,013,285 A44V possibly damaging Het
Sec14l2 G A 11: 4,111,435 probably benign Het
Sec31b T C 19: 44,536,156 N101D probably benign Het
Sema6a A T 18: 47,306,429 C9* probably null Het
Sept5 A C 16: 18,623,012 L331R probably benign Het
Slc16a11 C A 11: 70,215,651 Y238* probably null Het
Slc25a12 T C 2: 71,312,548 T210A probably benign Het
Slc35f1 A T 10: 53,089,347 Y286F probably damaging Het
Thap12 T C 7: 98,716,620 L665P probably damaging Het
Tpsb2 T A 17: 25,367,724 W237R probably damaging Het
Tyk2 T C 9: 21,120,341 D451G probably damaging Het
Ube2j1 T A 4: 33,049,696 N231K probably benign Het
Vmn1r225 A T 17: 20,502,590 T98S possibly damaging Het
Vmn1r87 A T 7: 13,131,821 S180T probably benign Het
Vmn2r6 A G 3: 64,537,841 V821A probably damaging Het
Zfp689 C A 7: 127,444,826 G211C probably damaging Het
Zfp827 A G 8: 79,076,236 D479G probably benign Het
Zfp995 A C 17: 21,880,594 F220V probably damaging Het
Other mutations in Szt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Szt2 APN 4 118384250 splice site probably benign
IGL01082:Szt2 APN 4 118397624 missense probably damaging 1.00
IGL01348:Szt2 APN 4 118393624 splice site probably benign
IGL01869:Szt2 APN 4 118399071 missense possibly damaging 0.87
IGL01918:Szt2 APN 4 118384253 splice site probably benign
IGL01951:Szt2 APN 4 118376493 unclassified probably benign
IGL01971:Szt2 APN 4 118386955 missense probably benign 0.01
IGL02047:Szt2 APN 4 118376637 unclassified probably benign
IGL02092:Szt2 APN 4 118363332 unclassified probably benign
IGL02120:Szt2 APN 4 118388564 missense probably benign 0.01
IGL02210:Szt2 APN 4 118389823 missense possibly damaging 0.95
IGL02435:Szt2 APN 4 118390823 missense probably damaging 1.00
IGL02622:Szt2 APN 4 118392890 missense probably damaging 0.96
IGL02666:Szt2 APN 4 118374055 missense probably damaging 0.99
IGL02712:Szt2 APN 4 118384833 missense probably benign 0.19
IGL02983:Szt2 APN 4 118365779 unclassified probably benign
IGL03026:Szt2 APN 4 118391849 missense probably benign 0.40
IGL03178:Szt2 APN 4 118382689 missense unknown
IGL03233:Szt2 APN 4 118372529 missense unknown
IGL03377:Szt2 APN 4 118402397 splice site probably benign
IGL03387:Szt2 APN 4 118364725 unclassified probably benign
PIT4687001:Szt2 UTSW 4 118398201 missense possibly damaging 0.84
R0026:Szt2 UTSW 4 118384772 missense possibly damaging 0.92
R0352:Szt2 UTSW 4 118382593 missense unknown
R0396:Szt2 UTSW 4 118376347 unclassified probably benign
R0504:Szt2 UTSW 4 118372952 splice site probably null
R1033:Szt2 UTSW 4 118387106 missense probably damaging 0.98
R1222:Szt2 UTSW 4 118405459 missense possibly damaging 0.77
R1418:Szt2 UTSW 4 118387779 missense probably benign 0.03
R1462:Szt2 UTSW 4 118373967 missense unknown
R1462:Szt2 UTSW 4 118373967 missense unknown
R1763:Szt2 UTSW 4 118372368 missense unknown
R1772:Szt2 UTSW 4 118405517 missense probably damaging 1.00
R1840:Szt2 UTSW 4 118365657 unclassified probably benign
R1942:Szt2 UTSW 4 118392620 missense probably benign 0.17
R1965:Szt2 UTSW 4 118383965 missense probably benign 0.36
R1998:Szt2 UTSW 4 118375727 critical splice donor site probably null
R2009:Szt2 UTSW 4 118378064 critical splice donor site probably null
R2012:Szt2 UTSW 4 118363665 unclassified probably benign
R2066:Szt2 UTSW 4 118373980 missense unknown
R2345:Szt2 UTSW 4 118381397 missense unknown
R2857:Szt2 UTSW 4 118369402 missense probably damaging 1.00
R3156:Szt2 UTSW 4 118402819 critical splice donor site probably null
R3236:Szt2 UTSW 4 118383034 splice site probably null
R3237:Szt2 UTSW 4 118383034 splice site probably null
R3405:Szt2 UTSW 4 118394020 missense probably benign 0.02
R3795:Szt2 UTSW 4 118391730 missense probably damaging 1.00
R3878:Szt2 UTSW 4 118390585 missense probably damaging 1.00
R3906:Szt2 UTSW 4 118378269 unclassified probably benign
R4012:Szt2 UTSW 4 118383900 missense probably benign 0.02
R4039:Szt2 UTSW 4 118364952 unclassified probably benign
R4081:Szt2 UTSW 4 118373567 splice site probably benign
R4298:Szt2 UTSW 4 118365406 unclassified probably benign
R4299:Szt2 UTSW 4 118365406 unclassified probably benign
R4432:Szt2 UTSW 4 118384231 missense probably damaging 0.99
R4597:Szt2 UTSW 4 118372681 missense unknown
R4657:Szt2 UTSW 4 118397669 missense probably benign 0.06
R4663:Szt2 UTSW 4 118377684 unclassified probably benign
R4670:Szt2 UTSW 4 118375829 unclassified probably benign
R4704:Szt2 UTSW 4 118393829 missense probably damaging 0.99
R4748:Szt2 UTSW 4 118389191 nonsense probably null
R4786:Szt2 UTSW 4 118399062 missense probably benign 0.20
R4809:Szt2 UTSW 4 118388985 missense probably damaging 1.00
R4830:Szt2 UTSW 4 118369248 missense unknown
R4944:Szt2 UTSW 4 118388669 missense probably benign 0.03
R5077:Szt2 UTSW 4 118369616 critical splice donor site probably null
R5121:Szt2 UTSW 4 118385444 missense possibly damaging 0.92
R5140:Szt2 UTSW 4 118386981 missense possibly damaging 0.46
R5169:Szt2 UTSW 4 118389830 missense probably benign 0.26
R5198:Szt2 UTSW 4 118388322 missense probably benign 0.03
R5433:Szt2 UTSW 4 118375466 unclassified probably benign
R5625:Szt2 UTSW 4 118373217 missense unknown
R5628:Szt2 UTSW 4 118373217 missense unknown
R5630:Szt2 UTSW 4 118392905 missense possibly damaging 0.83
R5808:Szt2 UTSW 4 118372613 missense unknown
R5902:Szt2 UTSW 4 118391503 missense probably benign 0.05
R6049:Szt2 UTSW 4 118402988 missense probably damaging 0.99
R6066:Szt2 UTSW 4 118371974 missense unknown
R6272:Szt2 UTSW 4 118374290 unclassified probably benign
R6456:Szt2 UTSW 4 118376697 unclassified probably benign
R6538:Szt2 UTSW 4 118390477 splice site probably null
R6604:Szt2 UTSW 4 118385474 missense probably benign 0.01
R6664:Szt2 UTSW 4 118391745 missense probably damaging 1.00
R6834:Szt2 UTSW 4 118388325 missense probably benign 0.01
R7109:Szt2 UTSW 4 118375479 missense unknown
R7163:Szt2 UTSW 4 118405530 missense possibly damaging 0.90
R7190:Szt2 UTSW 4 118389006 missense probably damaging 0.98
R7289:Szt2 UTSW 4 118375878 missense unknown
R7291:Szt2 UTSW 4 118391249 missense probably damaging 0.98
R7383:Szt2 UTSW 4 118365214 nonsense probably null
R7448:Szt2 UTSW 4 118363471 missense unknown
R7637:Szt2 UTSW 4 118393828 missense probably damaging 0.99
X0023:Szt2 UTSW 4 118372404 missense unknown
Predicted Primers PCR Primer
(F):5'- GCCACAGATGCAAAGATCCTG -3'
(R):5'- GCTGGTTCGGAATTGCAAG -3'

Sequencing Primer
(F):5'- GATCCTGAGGAAAGTCCCAGC -3'
(R):5'- TTCGGAATTGCAAGCTGACC -3'
Posted On2014-08-25