Mutagenetix > Incidental Mutation

Incidental Mutation 'R2044:Szt2'

221610

Institutional Source

Beutler Lab

Gene Symbol

Szt2

Ensembl Gene

ENSMUSG00000033253

Gene Name

seizure threshold 2

Synonyms

MMRRC Submission

040051-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.726) question?

Stock #

R2044 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118362743-118409273 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 118376448 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 2225 (L2225*)

Ref Sequence

ENSEMBL: ENSMUSP00000074862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075406]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000075406
AA Change: L2225*

SMART Domains

Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: L2225*

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Blast:VWA	93	343	1e-109	BLAST
low complexity region	704	728	N/A	INTRINSIC
low complexity region	762	775	N/A	INTRINSIC
low complexity region	779	793	N/A	INTRINSIC
low complexity region	875	887	N/A	INTRINSIC
low complexity region	994	1011	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC
low complexity region	1619	1630	N/A	INTRINSIC
low complexity region	1662	1678	N/A	INTRINSIC
low complexity region	1832	1854	N/A	INTRINSIC
low complexity region	1862	1881	N/A	INTRINSIC
low complexity region	1895	1914	N/A	INTRINSIC
low complexity region	2176	2184	N/A	INTRINSIC
low complexity region	2284	2292	N/A	INTRINSIC
low complexity region	2309	2323	N/A	INTRINSIC
low complexity region	2373	2384	N/A	INTRINSIC
low complexity region	2500	2508	N/A	INTRINSIC
low complexity region	2669	2680	N/A	INTRINSIC
low complexity region	2739	2758	N/A	INTRINSIC
low complexity region	3239	3252	N/A	INTRINSIC
low complexity region	3257	3268	N/A	INTRINSIC
low complexity region	3283	3309	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138386

Predicted Effect

probably benign
Transcript: ENSMUST00000183402

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.7%

Validation Efficiency

98% (92/94)

MGI Phenotype

FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410137M14Rik	G	A	17: 36,978,094		probably benign	Het
Abhd15	A	G	11: 77,518,338	T293A	probably benign	Het
Aldh1l1	C	T	6: 90,562,665	P192L	probably benign	Het
Aldoart1	T	G	4: 72,852,542	I10L	probably benign	Het
Ankhd1	G	A	18: 36,645,113	G1653D	probably benign	Het
Ankk1	A	C	9: 49,419,364		probably null	Het
Astn1	A	G	1: 158,600,502	T748A	possibly damaging	Het
Bmp7	C	A	2: 172,939,915	R52L	possibly damaging	Het
Ccdc151	T	G	9: 21,991,858	T419P	possibly damaging	Het
Ccdc33	G	A	9: 58,031,112	P859S	possibly damaging	Het
Ccny	A	G	18: 9,449,644	S10P	probably damaging	Het
Cdc6	C	A	11: 98,910,461	F179L	probably benign	Het
Cdc7	T	A	5: 106,983,132	V491E	probably benign	Het
Cdh23	G	T	10: 60,596,730	S138R	possibly damaging	Het
Cenpc1	T	C	5: 86,037,755	H299R	probably benign	Het
Ciart	A	T	3: 95,878,701	M354K	probably benign	Het
Clasrp	G	T	7: 19,586,715		probably benign	Het
Col4a3	G	A	1: 82,696,319	G1132E	unknown	Het
Crebbp	G	A	16: 4,084,823	T2184I	probably benign	Het
Cyp2r1	A	C	7: 114,550,405	M458R	probably damaging	Het
Cyp7a1	C	A	4: 6,275,492	R27M	probably null	Het
Ddhd2	A	G	8: 25,752,165	F116L	probably damaging	Het
Dgkd	G	A	1: 87,927,691	R685K	probably benign	Het
Dnah2	A	G	11: 69,524,240	S223P	probably benign	Het
Exph5	A	T	9: 53,372,679	R353S	possibly damaging	Het
F11	C	A	8: 45,252,118	V129F	probably benign	Het
F830045P16Rik	A	T	2: 129,459,397	S454T	possibly damaging	Het
Fam124a	T	C	14: 62,587,207	I50T	probably damaging	Het
Fam20c	T	C	5: 138,756,227		probably null	Het
Fam234b	A	G	6: 135,226,914	T405A	probably benign	Het
Fbxo18	C	A	2: 11,762,970	V356L	possibly damaging	Het
Flywch1	G	A	17: 23,762,313	Q132*	probably null	Het
Foxo6	T	C	4: 120,286,969	D95G	probably benign	Het
Ggt5	T	C	10: 75,604,087	F174S	probably damaging	Het
Gm7104	G	A	12: 88,285,781		noncoding transcript	Het
Gpr155	A	G	2: 73,373,633	L279P	probably damaging	Het
H2-T23	A	G	17: 36,032,191	L98P	probably damaging	Het
Heatr5a	A	G	12: 51,955,403	V250A	probably benign	Het
Heyl	A	T	4: 123,241,363	I50F	probably damaging	Het
Hist4h4	G	C	6: 136,804,103	R93G	possibly damaging	Het
Ifitm10	A	T	7: 142,356,034	S179R	probably damaging	Het
Isg15	A	T	4: 156,199,792	I93N	probably benign	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Itga10	G	A	3: 96,657,690	V985I	probably benign	Het
Kcnt2	T	C	1: 140,375,154	I144T	probably benign	Het
Klk1	A	C	7: 44,229,034	K104T	possibly damaging	Het
Lemd3	C	A	10: 120,933,442	R654L	probably damaging	Het
Lmod1	A	T	1: 135,364,387	M327L	probably benign	Het
Lonrf2	T	C	1: 38,807,050	E347G	probably benign	Het
Ltbp1	A	G	17: 75,276,432	Y409C	probably damaging	Het
Mecom	A	T	3: 29,980,592	Y312N	probably damaging	Het
Mrgprb3	C	T	7: 48,643,734	C23Y	possibly damaging	Het
Mut	A	G	17: 40,941,451	T295A	probably benign	Het
Nadk	C	A	4: 155,585,441	L194I	probably damaging	Het
Naxd	A	G	8: 11,509,510	I182V	probably benign	Het
Nbeal1	T	A	1: 60,319,687	I1176K	probably damaging	Het
Nol4l	C	A	2: 153,529,521	R81L	possibly damaging	Het
Olfr1297	T	A	2: 111,621,814	R87W	probably benign	Het
Olfr1411	G	T	1: 92,596,969	R150L	probably benign	Het
Olfr957	A	T	9: 39,511,378	M114K	probably damaging	Het
Pcdh18	A	G	3: 49,754,940	V642A	probably benign	Het
Pdzk1	G	A	3: 96,855,848		probably benign	Het
Per3	C	T	4: 151,033,938	V233I	probably benign	Het
Pisd	G	A	5: 32,764,796	P267S	possibly damaging	Het
Prm1	T	A	16: 10,796,493		probably benign	Het
Ptprj	A	G	2: 90,463,095	V548A	probably damaging	Het
Ranbp3	G	A	17: 56,673,367		probably benign	Het
Raver2	T	A	4: 101,102,812	V163D	probably damaging	Het
Rbm14	A	T	19: 4,803,877	I159N	possibly damaging	Het
Rfx6	G	A	10: 51,718,126	V381I	probably benign	Het
Rhobtb1	T	C	10: 69,272,863		probably benign	Het
Rpl28-ps4	T	A	6: 117,213,895		noncoding transcript	Het
Rsph10b	A	G	5: 143,967,250		probably null	Het
Rspo4	A	G	2: 151,873,093	K217E	unknown	Het
Scgb2b27	G	A	7: 34,013,285	A44V	possibly damaging	Het
Sec14l2	G	A	11: 4,111,435		probably benign	Het
Sec31b	T	C	19: 44,536,156	N101D	probably benign	Het
Sema6a	A	T	18: 47,306,429	C9*	probably null	Het
Sept5	A	C	16: 18,623,012	L331R	probably benign	Het
Slc16a11	C	A	11: 70,215,651	Y238*	probably null	Het
Slc25a12	T	C	2: 71,312,548	T210A	probably benign	Het
Slc35f1	A	T	10: 53,089,347	Y286F	probably damaging	Het
Thap12	T	C	7: 98,716,620	L665P	probably damaging	Het
Tpsb2	T	A	17: 25,367,724	W237R	probably damaging	Het
Tyk2	T	C	9: 21,120,341	D451G	probably damaging	Het
Ube2j1	T	A	4: 33,049,696	N231K	probably benign	Het
Vmn1r225	A	T	17: 20,502,590	T98S	possibly damaging	Het
Vmn1r87	A	T	7: 13,131,821	S180T	probably benign	Het
Vmn2r6	A	G	3: 64,537,841	V821A	probably damaging	Het
Zfp689	C	A	7: 127,444,826	G211C	probably damaging	Het
Zfp827	A	G	8: 79,076,236	D479G	probably benign	Het
Zfp995	A	C	17: 21,880,594	F220V	probably damaging	Het

Other mutations in Szt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Szt2	APN	4	118384250	splice site	probably benign
IGL01082:Szt2	APN	4	118397624	missense	probably damaging	1.00
IGL01348:Szt2	APN	4	118393624	splice site	probably benign
IGL01869:Szt2	APN	4	118399071	missense	possibly damaging	0.87
IGL01918:Szt2	APN	4	118384253	splice site	probably benign
IGL01951:Szt2	APN	4	118376493	unclassified	probably benign
IGL01971:Szt2	APN	4	118386955	missense	probably benign	0.01
IGL02047:Szt2	APN	4	118376637	unclassified	probably benign
IGL02092:Szt2	APN	4	118363332	unclassified	probably benign
IGL02120:Szt2	APN	4	118388564	missense	probably benign	0.01
IGL02210:Szt2	APN	4	118389823	missense	possibly damaging	0.95
IGL02435:Szt2	APN	4	118390823	missense	probably damaging	1.00
IGL02622:Szt2	APN	4	118392890	missense	probably damaging	0.96
IGL02666:Szt2	APN	4	118374055	missense	probably damaging	0.99
IGL02712:Szt2	APN	4	118384833	missense	probably benign	0.19
IGL02983:Szt2	APN	4	118365779	unclassified	probably benign
IGL03026:Szt2	APN	4	118391849	missense	probably benign	0.40
IGL03178:Szt2	APN	4	118382689	missense	unknown
IGL03233:Szt2	APN	4	118372529	missense	unknown
IGL03377:Szt2	APN	4	118402397	splice site	probably benign
IGL03387:Szt2	APN	4	118364725	unclassified	probably benign
PIT4687001:Szt2	UTSW	4	118398201	missense	possibly damaging	0.84
R0026:Szt2	UTSW	4	118384772	missense	possibly damaging	0.92
R0352:Szt2	UTSW	4	118382593	missense	unknown
R0396:Szt2	UTSW	4	118376347	unclassified	probably benign
R0504:Szt2	UTSW	4	118372952	splice site	probably null
R1033:Szt2	UTSW	4	118387106	missense	probably damaging	0.98
R1222:Szt2	UTSW	4	118405459	missense	possibly damaging	0.77
R1418:Szt2	UTSW	4	118387779	missense	probably benign	0.03
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1763:Szt2	UTSW	4	118372368	missense	unknown
R1772:Szt2	UTSW	4	118405517	missense	probably damaging	1.00
R1840:Szt2	UTSW	4	118365657	unclassified	probably benign
R1942:Szt2	UTSW	4	118392620	missense	probably benign	0.17
R1965:Szt2	UTSW	4	118383965	missense	probably benign	0.36
R1998:Szt2	UTSW	4	118375727	critical splice donor site	probably null
R2009:Szt2	UTSW	4	118378064	critical splice donor site	probably null
R2012:Szt2	UTSW	4	118363665	unclassified	probably benign
R2066:Szt2	UTSW	4	118373980	missense	unknown
R2345:Szt2	UTSW	4	118381397	missense	unknown
R2857:Szt2	UTSW	4	118369402	missense	probably damaging	1.00
R3156:Szt2	UTSW	4	118402819	critical splice donor site	probably null
R3236:Szt2	UTSW	4	118383034	splice site	probably null
R3237:Szt2	UTSW	4	118383034	splice site	probably null
R3405:Szt2	UTSW	4	118394020	missense	probably benign	0.02
R3795:Szt2	UTSW	4	118391730	missense	probably damaging	1.00
R3878:Szt2	UTSW	4	118390585	missense	probably damaging	1.00
R3906:Szt2	UTSW	4	118378269	unclassified	probably benign
R4012:Szt2	UTSW	4	118383900	missense	probably benign	0.02
R4039:Szt2	UTSW	4	118364952	unclassified	probably benign
R4081:Szt2	UTSW	4	118373567	splice site	probably benign
R4298:Szt2	UTSW	4	118365406	unclassified	probably benign
R4299:Szt2	UTSW	4	118365406	unclassified	probably benign
R4432:Szt2	UTSW	4	118384231	missense	probably damaging	0.99
R4597:Szt2	UTSW	4	118372681	missense	unknown
R4657:Szt2	UTSW	4	118397669	missense	probably benign	0.06
R4663:Szt2	UTSW	4	118377684	unclassified	probably benign
R4670:Szt2	UTSW	4	118375829	unclassified	probably benign
R4704:Szt2	UTSW	4	118393829	missense	probably damaging	0.99
R4748:Szt2	UTSW	4	118389191	nonsense	probably null
R4786:Szt2	UTSW	4	118399062	missense	probably benign	0.20
R4809:Szt2	UTSW	4	118388985	missense	probably damaging	1.00
R4830:Szt2	UTSW	4	118369248	missense	unknown
R4944:Szt2	UTSW	4	118388669	missense	probably benign	0.03
R5077:Szt2	UTSW	4	118369616	critical splice donor site	probably null
R5121:Szt2	UTSW	4	118385444	missense	possibly damaging	0.92
R5140:Szt2	UTSW	4	118386981	missense	possibly damaging	0.46
R5169:Szt2	UTSW	4	118389830	missense	probably benign	0.26
R5198:Szt2	UTSW	4	118388322	missense	probably benign	0.03
R5433:Szt2	UTSW	4	118375466	unclassified	probably benign
R5625:Szt2	UTSW	4	118373217	missense	unknown
R5628:Szt2	UTSW	4	118373217	missense	unknown
R5630:Szt2	UTSW	4	118392905	missense	possibly damaging	0.83
R5808:Szt2	UTSW	4	118372613	missense	unknown
R5902:Szt2	UTSW	4	118391503	missense	probably benign	0.05
R6049:Szt2	UTSW	4	118402988	missense	probably damaging	0.99
R6066:Szt2	UTSW	4	118371974	missense	unknown
R6272:Szt2	UTSW	4	118374290	unclassified	probably benign
R6456:Szt2	UTSW	4	118376697	unclassified	probably benign
R6538:Szt2	UTSW	4	118390477	splice site	probably null
R6604:Szt2	UTSW	4	118385474	missense	probably benign	0.01
R6664:Szt2	UTSW	4	118391745	missense	probably damaging	1.00
R6834:Szt2	UTSW	4	118388325	missense	probably benign	0.01
R7109:Szt2	UTSW	4	118375479	missense	unknown
R7163:Szt2	UTSW	4	118405530	missense	possibly damaging	0.90
R7190:Szt2	UTSW	4	118389006	missense	probably damaging	0.98
R7289:Szt2	UTSW	4	118375878	missense	unknown
R7291:Szt2	UTSW	4	118391249	missense	probably damaging	0.98
R7383:Szt2	UTSW	4	118365214	nonsense	probably null
R7448:Szt2	UTSW	4	118363471	missense	unknown
R7637:Szt2	UTSW	4	118393828	missense	probably damaging	0.99
R7833:Szt2	UTSW	4	118366219	missense	unknown
R7896:Szt2	UTSW	4	118402913	missense	possibly damaging	0.62
R7923:Szt2	UTSW	4	118373840	missense	unknown
R8090:Szt2	UTSW	4	118387002	splice site	probably null
R8103:Szt2	UTSW	4	118387864	missense	possibly damaging	0.88
R8288:Szt2	UTSW	4	118389776	missense	probably damaging	0.96
R8309:Szt2	UTSW	4	118375482	frame shift	probably null
R8341:Szt2	UTSW	4	118392836	missense	possibly damaging	0.63
R8480:Szt2	UTSW	4	118386818	missense	probably benign	0.01
R8497:Szt2	UTSW	4	118388321	missense	possibly damaging	0.94
R8549:Szt2	UTSW	4	118372681	missense	unknown
R8768:Szt2	UTSW	4	118369416	missense	unknown
R8992:Szt2	UTSW	4	118382788	splice site	probably benign
R9001:Szt2	UTSW	4	118378332	missense	unknown
R9094:Szt2	UTSW	4	118385454	missense	possibly damaging	0.74
R9110:Szt2	UTSW	4	118385433	missense	possibly damaging	0.89
R9129:Szt2	UTSW	4	118364669	missense	unknown
R9184:Szt2	UTSW	4	118384529	missense	possibly damaging	0.92
R9186:Szt2	UTSW	4	118385091	missense	probably damaging	1.00
R9424:Szt2	UTSW	4	118390954	missense	probably damaging	1.00
R9598:Szt2	UTSW	4	118409161	critical splice donor site	probably null
X0023:Szt2	UTSW	4	118372404	missense	unknown
Z1176:Szt2	UTSW	4	118393976	missense	probably damaging	0.99
Z1177:Szt2	UTSW	4	118391214	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCACAGATGCAAAGATCCTG -3'
(R):5'- GCTGGTTCGGAATTGCAAG -3'

Sequencing Primer
(F):5'- GATCCTGAGGAAAGTCCCAGC -3'
(R):5'- TTCGGAATTGCAAGCTGACC -3'

Posted On

2014-08-25