Incidental Mutation 'R2044:Per3'
ID221616
Institutional Source Beutler Lab
Gene Symbol Per3
Ensembl Gene ENSMUSG00000028957
Gene Nameperiod circadian clock 3
SynonymsmPer3, 2810049O06Rik
MMRRC Submission 040051-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R2044 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location151003652-151044665 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 151033938 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 233 (V233I)
Ref Sequence ENSEMBL: ENSMUSP00000099493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103204] [ENSMUST00000136398] [ENSMUST00000169423]
PDB Structure
Unwinding the Differences of the Mammalian PERIOD Clock Proteins from Crystal Structure to Cellular Function [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000103204
AA Change: V233I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000099493
Gene: ENSMUSG00000028957
AA Change: V233I

DomainStartEndE-ValueType
PAS 115 187 2.86e1 SMART
PAS 258 324 1.31e-5 SMART
PAC 333 376 1.52e-1 SMART
low complexity region 414 427 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
low complexity region 799 814 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
Pfam:Period_C 905 1111 4.4e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128283
Predicted Effect probably benign
Transcript: ENSMUST00000136398
AA Change: V233I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118950
Gene: ENSMUSG00000028957
AA Change: V233I

DomainStartEndE-ValueType
PAS 115 187 2.86e1 SMART
PAS 258 324 1.31e-5 SMART
PAC 333 376 3.25e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138584
Predicted Effect probably benign
Transcript: ENSMUST00000169423
SMART Domains Protein: ENSMUSP00000127916
Gene: ENSMUSG00000014592

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene have been linked to sleep disorders. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit a shorter circadian cycle length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 36,978,094 probably benign Het
Abhd15 A G 11: 77,518,338 T293A probably benign Het
Aldh1l1 C T 6: 90,562,665 P192L probably benign Het
Aldoart1 T G 4: 72,852,542 I10L probably benign Het
Ankhd1 G A 18: 36,645,113 G1653D probably benign Het
Ankk1 A C 9: 49,419,364 probably null Het
Astn1 A G 1: 158,600,502 T748A possibly damaging Het
Bmp7 C A 2: 172,939,915 R52L possibly damaging Het
Ccdc151 T G 9: 21,991,858 T419P possibly damaging Het
Ccdc33 G A 9: 58,031,112 P859S possibly damaging Het
Ccny A G 18: 9,449,644 S10P probably damaging Het
Cdc6 C A 11: 98,910,461 F179L probably benign Het
Cdc7 T A 5: 106,983,132 V491E probably benign Het
Cdh23 G T 10: 60,596,730 S138R possibly damaging Het
Cenpc1 T C 5: 86,037,755 H299R probably benign Het
Ciart A T 3: 95,878,701 M354K probably benign Het
Clasrp G T 7: 19,586,715 probably benign Het
Col4a3 G A 1: 82,696,319 G1132E unknown Het
Crebbp G A 16: 4,084,823 T2184I probably benign Het
Cyp2r1 A C 7: 114,550,405 M458R probably damaging Het
Cyp7a1 C A 4: 6,275,492 R27M probably null Het
Ddhd2 A G 8: 25,752,165 F116L probably damaging Het
Dgkd G A 1: 87,927,691 R685K probably benign Het
Dnah2 A G 11: 69,524,240 S223P probably benign Het
Exph5 A T 9: 53,372,679 R353S possibly damaging Het
F11 C A 8: 45,252,118 V129F probably benign Het
F830045P16Rik A T 2: 129,459,397 S454T possibly damaging Het
Fam124a T C 14: 62,587,207 I50T probably damaging Het
Fam20c T C 5: 138,756,227 probably null Het
Fam234b A G 6: 135,226,914 T405A probably benign Het
Fbxo18 C A 2: 11,762,970 V356L possibly damaging Het
Flywch1 G A 17: 23,762,313 Q132* probably null Het
Foxo6 T C 4: 120,286,969 D95G probably benign Het
Ggt5 T C 10: 75,604,087 F174S probably damaging Het
Gm7104 G A 12: 88,285,781 noncoding transcript Het
Gpr155 A G 2: 73,373,633 L279P probably damaging Het
H2-T23 A G 17: 36,032,191 L98P probably damaging Het
Heatr5a A G 12: 51,955,403 V250A probably benign Het
Heyl A T 4: 123,241,363 I50F probably damaging Het
Hist4h4 G C 6: 136,804,103 R93G possibly damaging Het
Ifitm10 A T 7: 142,356,034 S179R probably damaging Het
Isg15 A T 4: 156,199,792 I93N probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itga10 G A 3: 96,657,690 V985I probably benign Het
Kcnt2 T C 1: 140,375,154 I144T probably benign Het
Klk1 A C 7: 44,229,034 K104T possibly damaging Het
Lemd3 C A 10: 120,933,442 R654L probably damaging Het
Lmod1 A T 1: 135,364,387 M327L probably benign Het
Lonrf2 T C 1: 38,807,050 E347G probably benign Het
Ltbp1 A G 17: 75,276,432 Y409C probably damaging Het
Mecom A T 3: 29,980,592 Y312N probably damaging Het
Mrgprb3 C T 7: 48,643,734 C23Y possibly damaging Het
Mut A G 17: 40,941,451 T295A probably benign Het
Nadk C A 4: 155,585,441 L194I probably damaging Het
Naxd A G 8: 11,509,510 I182V probably benign Het
Nbeal1 T A 1: 60,319,687 I1176K probably damaging Het
Nol4l C A 2: 153,529,521 R81L possibly damaging Het
Olfr1297 T A 2: 111,621,814 R87W probably benign Het
Olfr1411 G T 1: 92,596,969 R150L probably benign Het
Olfr957 A T 9: 39,511,378 M114K probably damaging Het
Pcdh18 A G 3: 49,754,940 V642A probably benign Het
Pdzk1 G A 3: 96,855,848 probably benign Het
Pisd G A 5: 32,764,796 P267S possibly damaging Het
Prm1 T A 16: 10,796,493 probably benign Het
Ptprj A G 2: 90,463,095 V548A probably damaging Het
Ranbp3 G A 17: 56,673,367 probably benign Het
Raver2 T A 4: 101,102,812 V163D probably damaging Het
Rbm14 A T 19: 4,803,877 I159N possibly damaging Het
Rfx6 G A 10: 51,718,126 V381I probably benign Het
Rhobtb1 T C 10: 69,272,863 probably benign Het
Rpl28-ps4 T A 6: 117,213,895 noncoding transcript Het
Rsph10b A G 5: 143,967,250 probably null Het
Rspo4 A G 2: 151,873,093 K217E unknown Het
Scgb2b27 G A 7: 34,013,285 A44V possibly damaging Het
Sec14l2 G A 11: 4,111,435 probably benign Het
Sec31b T C 19: 44,536,156 N101D probably benign Het
Sema6a A T 18: 47,306,429 C9* probably null Het
Sept5 A C 16: 18,623,012 L331R probably benign Het
Slc16a11 C A 11: 70,215,651 Y238* probably null Het
Slc25a12 T C 2: 71,312,548 T210A probably benign Het
Slc35f1 A T 10: 53,089,347 Y286F probably damaging Het
Szt2 A T 4: 118,376,448 L2225* probably null Het
Thap12 T C 7: 98,716,620 L665P probably damaging Het
Tpsb2 T A 17: 25,367,724 W237R probably damaging Het
Tyk2 T C 9: 21,120,341 D451G probably damaging Het
Ube2j1 T A 4: 33,049,696 N231K probably benign Het
Vmn1r225 A T 17: 20,502,590 T98S possibly damaging Het
Vmn1r87 A T 7: 13,131,821 S180T probably benign Het
Vmn2r6 A G 3: 64,537,841 V821A probably damaging Het
Zfp689 C A 7: 127,444,826 G211C probably damaging Het
Zfp827 A G 8: 79,076,236 D479G probably benign Het
Zfp995 A C 17: 21,880,594 F220V probably damaging Het
Other mutations in Per3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Per3 APN 4 151013598 missense probably benign 0.28
IGL02112:Per3 APN 4 151029183 missense probably benign 0.20
IGL02428:Per3 APN 4 151018217 critical splice donor site probably null
IGL02812:Per3 APN 4 151024470 missense probably damaging 0.99
IGL03094:Per3 APN 4 151009298 missense probably damaging 1.00
R0119:Per3 UTSW 4 151024548 intron probably benign
R0565:Per3 UTSW 4 151033952 missense probably damaging 1.00
R0671:Per3 UTSW 4 151028831 missense probably benign 0.27
R1186:Per3 UTSW 4 151026138 missense probably damaging 0.99
R1736:Per3 UTSW 4 151009248 critical splice donor site probably null
R1757:Per3 UTSW 4 151042792 critical splice acceptor site probably null
R1900:Per3 UTSW 4 151041426 missense probably damaging 1.00
R1929:Per3 UTSW 4 151018885 missense probably damaging 1.00
R2272:Per3 UTSW 4 151018885 missense probably damaging 1.00
R2415:Per3 UTSW 4 151012690 missense possibly damaging 0.91
R4771:Per3 UTSW 4 151009259 missense probably damaging 1.00
R5199:Per3 UTSW 4 151012895 missense probably benign 0.15
R5298:Per3 UTSW 4 151029209 missense probably damaging 1.00
R5330:Per3 UTSW 4 151041302 missense probably damaging 1.00
R5331:Per3 UTSW 4 151041302 missense probably damaging 1.00
R5920:Per3 UTSW 4 151012450 missense probably benign 0.05
R5974:Per3 UTSW 4 151042737 missense possibly damaging 0.83
R6498:Per3 UTSW 4 151029205 missense probably benign 0.27
R6907:Per3 UTSW 4 151043558 critical splice donor site probably null
R6915:Per3 UTSW 4 151043649 missense possibly damaging 0.84
R7269:Per3 UTSW 4 151031936 nonsense probably null
R7454:Per3 UTSW 4 151012728 missense probably benign 0.05
R7555:Per3 UTSW 4 151018058 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCTGTCCTAGACCTACAGACGC -3'
(R):5'- GGGAGACTGAGATTTCCAGC -3'

Sequencing Primer
(F):5'- TAGACCTACAGACGCTGCTATCTC -3'
(R):5'- GGAGACTGAGATTTCCAGCTACTTC -3'
Posted On2014-08-25