Incidental Mutation 'R1975:Triobp'
ID221635
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene NameTRIO and F-actin binding protein
SynonymsEST478828, Mus EST 478828, Tara
MMRRC Submission 039988-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1975 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location78947724-79005869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78966708 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 354 (V354A)
Ref Sequence ENSEMBL: ENSMUSP00000155397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000140228]
Predicted Effect probably benign
Transcript: ENSMUST00000109689
AA Change: V354A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: V354A

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109690
AA Change: V354A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: V354A

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140228
AA Change: V354A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 96% (71/74)
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 T C 5: 121,604,259 T429A probably benign Het
Afmid A C 11: 117,836,474 I275L probably benign Het
Aimp1 A C 3: 132,677,099 D5E possibly damaging Het
Aldob G A 4: 49,538,171 A319V probably benign Het
Ankar C T 1: 72,658,441 V1068I possibly damaging Het
Ccr2 C T 9: 124,106,793 S370L probably benign Het
Chrnb4 A G 9: 55,034,818 Y391H probably damaging Het
Clip1 A G 5: 123,623,218 M873T possibly damaging Het
Cspg4 G C 9: 56,890,478 G1409R probably damaging Het
Dnah17 A T 11: 118,096,536 L1320* probably null Het
Dock4 T C 12: 40,779,642 probably benign Het
Eml4 T C 17: 83,410,193 S65P probably benign Het
Fblim1 A T 4: 141,584,864 D183E probably damaging Het
Foxn1 T C 11: 78,365,937 probably benign Het
Gm973 A T 1: 59,562,771 T515S possibly damaging Het
Hdac7 G A 15: 97,806,505 Q495* probably null Het
Hipk3 T C 2: 104,471,173 I225V probably benign Het
Hrc A T 7: 45,336,214 D263V probably damaging Het
Hs6st3 T C 14: 119,138,476 I21T probably benign Het
Il15ra A G 2: 11,723,523 T133A possibly damaging Het
Krt78 T C 15: 101,946,168 *1069W probably null Het
Lama3 T A 18: 12,453,863 M761K probably damaging Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Macf1 T C 4: 123,489,212 T1320A probably damaging Het
Mark3 A T 12: 111,615,441 I115L probably damaging Het
Mcph1 T G 8: 18,689,065 probably benign Het
Med23 T A 10: 24,910,766 N923K probably benign Het
Msrb2 T G 2: 19,393,221 Y97D probably damaging Het
Muc6 C T 7: 141,648,101 G708S probably damaging Het
Mylk T C 16: 34,880,303 probably null Het
Nfrkb T A 9: 31,414,684 V1141E possibly damaging Het
Obscn T C 11: 59,067,729 E3675G probably damaging Het
Olfr1053 C G 2: 86,315,154 G44A probably damaging Het
Olfr167 G A 16: 19,514,836 P267S probably damaging Het
Olfr203 T C 16: 59,303,728 S193P probably damaging Het
Olfr612 A T 7: 103,538,994 F80Y probably damaging Het
Olfr619 A G 7: 103,604,012 probably null Het
Olfr720 A T 14: 14,175,446 V212E probably damaging Het
Olfr746 T A 14: 50,653,364 N42K probably damaging Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Pdgfc C T 3: 81,209,245 T302I probably damaging Het
Pkhd1l1 G T 15: 44,529,713 V1815F probably damaging Het
Pnpt1 A G 11: 29,141,256 I337V probably benign Het
Psma8 T G 18: 14,730,976 probably null Het
Rbl2 T C 8: 91,085,462 S220P probably benign Het
Rere T A 4: 150,615,733 D1091E probably damaging Het
Rpa1 A G 11: 75,306,176 C540R probably damaging Het
Sema3d T A 5: 12,563,318 V454E probably damaging Het
Sema3d T C 5: 12,584,998 V677A probably benign Het
Sgk2 A G 2: 163,004,160 N207S probably benign Het
Sirpb1a T C 3: 15,379,081 I370V probably benign Het
Slc22a19 A G 19: 7,683,859 probably benign Het
Slc26a1 T A 5: 108,672,472 D287V probably damaging Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Slco1b2 A T 6: 141,683,225 Y551F probably damaging Het
Slco2a1 T A 9: 103,079,454 Y488* probably null Het
Stab2 A C 10: 86,896,496 probably null Het
Strn T C 17: 78,692,499 probably null Het
Tbxas1 A G 6: 38,948,641 probably benign Het
Thumpd3 A G 6: 113,055,877 N192S possibly damaging Het
Tns3 T A 11: 8,435,738 I1386F probably benign Het
Treml4 T A 17: 48,272,793 V219E probably damaging Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Tub G A 7: 109,027,835 G314R possibly damaging Het
Ube3b C T 5: 114,399,865 T339M possibly damaging Het
Vmn2r43 A G 7: 8,255,551 I221T possibly damaging Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Zfp110 C T 7: 12,848,502 T359I probably benign Het
Zfp322a A T 13: 23,356,904 C223S probably damaging Het
Zfp512b G A 2: 181,587,085 R696* probably null Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78993368 missense probably damaging 1.00
IGL01904:Triobp APN 15 78967364 missense possibly damaging 0.80
IGL01957:Triobp APN 15 78972647 critical splice donor site probably null
IGL02085:Triobp APN 15 78974297 splice site probably benign
IGL02260:Triobp APN 15 78966362 missense probably benign 0.00
IGL02498:Triobp APN 15 78961043 missense probably benign 0.01
IGL02551:Triobp APN 15 78973489 missense probably benign
IGL02740:Triobp APN 15 78966689 missense probably benign 0.21
IGL02810:Triobp APN 15 79002203 missense possibly damaging 0.95
IGL03063:Triobp APN 15 78990884 missense probably damaging 1.00
FR4304:Triobp UTSW 15 78993387 unclassified probably benign
FR4340:Triobp UTSW 15 78993390 unclassified probably benign
FR4342:Triobp UTSW 15 78993392 unclassified probably benign
FR4449:Triobp UTSW 15 78993389 unclassified probably benign
FR4548:Triobp UTSW 15 78993387 unclassified probably benign
FR4548:Triobp UTSW 15 78993390 unclassified probably benign
R0276:Triobp UTSW 15 78973676 missense probably benign 0.09
R0309:Triobp UTSW 15 78976540 missense probably damaging 1.00
R0433:Triobp UTSW 15 78968201 missense possibly damaging 0.69
R0464:Triobp UTSW 15 78966986 missense possibly damaging 0.71
R0525:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0665:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0689:Triobp UTSW 15 78959988 nonsense probably null
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1151:Triobp UTSW 15 78966479 missense probably benign 0.00
R1152:Triobp UTSW 15 78966479 missense probably benign 0.00
R1510:Triobp UTSW 15 79003767 missense probably damaging 1.00
R1519:Triobp UTSW 15 78973738 missense probably benign 0.00
R1642:Triobp UTSW 15 79002148 missense probably damaging 1.00
R1732:Triobp UTSW 15 78967228 missense possibly damaging 0.69
R1755:Triobp UTSW 15 78966479 missense probably benign 0.00
R2051:Triobp UTSW 15 79004540 missense probably damaging 1.00
R2073:Triobp UTSW 15 78973895 missense probably damaging 0.99
R2260:Triobp UTSW 15 78991440 critical splice donor site probably null
R2351:Triobp UTSW 15 79004580 missense probably benign 0.09
R2902:Triobp UTSW 15 78973418 missense possibly damaging 0.90
R3801:Triobp UTSW 15 78973700 missense probably benign 0.04
R3959:Triobp UTSW 15 79002389 nonsense probably null
R4003:Triobp UTSW 15 78959977 unclassified probably benign
R4084:Triobp UTSW 15 78973671 missense probably benign 0.19
R4482:Triobp UTSW 15 78966563 missense possibly damaging 0.87
R4592:Triobp UTSW 15 78967095 missense probably benign
R4662:Triobp UTSW 15 78993269 missense probably damaging 1.00
R4732:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4733:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4789:Triobp UTSW 15 78991028 missense probably damaging 1.00
R4968:Triobp UTSW 15 78966616 missense probably benign 0.03
R4990:Triobp UTSW 15 78967005 missense probably benign 0.00
R5129:Triobp UTSW 15 78961096 missense probably benign 0.15
R5181:Triobp UTSW 15 78967754 missense probably benign 0.00
R5279:Triobp UTSW 15 78994391 missense possibly damaging 0.66
R5584:Triobp UTSW 15 78968132 missense possibly damaging 0.89
R5601:Triobp UTSW 15 78973633 missense probably damaging 1.00
R5810:Triobp UTSW 15 78968267 missense probably benign 0.07
R5969:Triobp UTSW 15 78967540 missense probably benign 0.05
R6722:Triobp UTSW 15 79001565 missense probably damaging 1.00
R6739:Triobp UTSW 15 78966366 missense possibly damaging 0.77
R6810:Triobp UTSW 15 78966615 missense possibly damaging 0.47
R7011:Triobp UTSW 15 78978723 missense probably damaging 0.98
R7015:Triobp UTSW 15 78994060 missense probably damaging 0.99
R7200:Triobp UTSW 15 78966842 small deletion probably benign
R7294:Triobp UTSW 15 78973976 missense probably damaging 0.99
R7688:Triobp UTSW 15 78961111 splice site probably null
R7805:Triobp UTSW 15 78974004 missense probably benign 0.37
R7972:Triobp UTSW 15 78967986 missense probably damaging 1.00
R7977:Triobp UTSW 15 79001544 missense probably damaging 1.00
R7987:Triobp UTSW 15 79001544 missense probably damaging 1.00
R7999:Triobp UTSW 15 78959944 missense probably damaging 0.99
R8344:Triobp UTSW 15 78958275 missense possibly damaging 0.67
R8348:Triobp UTSW 15 78994126 missense possibly damaging 0.85
RF001:Triobp UTSW 15 78967027 small insertion probably benign
RF005:Triobp UTSW 15 78967061 small insertion probably benign
RF007:Triobp UTSW 15 78967044 small insertion probably benign
RF022:Triobp UTSW 15 78974282 missense probably benign 0.05
RF028:Triobp UTSW 15 78967039 small insertion probably benign
RF032:Triobp UTSW 15 78967036 small insertion probably benign
RF035:Triobp UTSW 15 78967039 small insertion probably benign
RF039:Triobp UTSW 15 78967036 small insertion probably benign
RF039:Triobp UTSW 15 78967039 small insertion probably benign
RF040:Triobp UTSW 15 78967063 small insertion probably benign
RF049:Triobp UTSW 15 78967061 small insertion probably benign
RF051:Triobp UTSW 15 78967034 small insertion probably benign
RF058:Triobp UTSW 15 78967044 small insertion probably benign
X0026:Triobp UTSW 15 78960023 missense possibly damaging 0.94
Z1177:Triobp UTSW 15 79002181 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCCTGCACAAGAAGCTC -3'
(R):5'- GTTGTCCCGCTGAGTAGTTC -3'

Sequencing Primer
(F):5'- CCAAAGGGACACACAGCGG -3'
(R):5'- CCCGCTGAGTAGTTCTGTTG -3'
Posted On2014-08-25