Incidental Mutation 'R2044:Cyp2r1'
ID221660
Institutional Source Beutler Lab
Gene Symbol Cyp2r1
Ensembl Gene ENSMUSG00000030670
Gene Namecytochrome P450, family 2, subfamily r, polypeptide 1
Synonyms
MMRRC Submission 040051-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2044 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location114549682-114562972 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 114550405 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 458 (M458R)
Ref Sequence ENSEMBL: ENSMUSP00000032908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032908] [ENSMUST00000119712] [ENSMUST00000128587] [ENSMUST00000138712] [ENSMUST00000147428] [ENSMUST00000211506]
Predicted Effect probably damaging
Transcript: ENSMUST00000032908
AA Change: M458R

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032908
Gene: ENSMUSG00000030670
AA Change: M458R

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:p450 40 498 7e-122 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119712
AA Change: M247R

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112818
Gene: ENSMUSG00000030670
AA Change: M247R

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:p450 40 124 2.3e-15 PFAM
Pfam:p450 115 287 1.8e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128587
SMART Domains Protein: ENSMUSP00000121924
Gene: ENSMUSG00000030670

DomainStartEndE-ValueType
Pfam:p450 1 260 5.7e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133484
Predicted Effect probably benign
Transcript: ENSMUST00000138712
SMART Domains Protein: ENSMUSP00000123556
Gene: ENSMUSG00000030670

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
SCOP:d1dt6a_ 40 76 5e-7 SMART
PDB:3CZH|B 51 76 3e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000147428
SMART Domains Protein: ENSMUSP00000119605
Gene: ENSMUSG00000030670

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
SCOP:d1dt6a_ 40 76 5e-7 SMART
PDB:3CZH|B 51 76 3e-7 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000211506
AA Change: M249R

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.7790 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This enzyme is a microsomal vitamin D hydroxylase that converts vitamin D into the active ligand for the vitamin D receptor. A mutation in this gene has been associated with selective 25-hydroxyvitamin D deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit more than a 50% reduction in serum 25-hydroxyvitamin D3 levels but remain healthy and show normal serum 1alpha,25-dihydroxyvitamin D3 levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 36,978,094 probably benign Het
Abhd15 A G 11: 77,518,338 T293A probably benign Het
Aldh1l1 C T 6: 90,562,665 P192L probably benign Het
Aldoart1 T G 4: 72,852,542 I10L probably benign Het
Ankhd1 G A 18: 36,645,113 G1653D probably benign Het
Ankk1 A C 9: 49,419,364 probably null Het
Astn1 A G 1: 158,600,502 T748A possibly damaging Het
Bmp7 C A 2: 172,939,915 R52L possibly damaging Het
Ccdc151 T G 9: 21,991,858 T419P possibly damaging Het
Ccdc33 G A 9: 58,031,112 P859S possibly damaging Het
Ccny A G 18: 9,449,644 S10P probably damaging Het
Cdc6 C A 11: 98,910,461 F179L probably benign Het
Cdc7 T A 5: 106,983,132 V491E probably benign Het
Cdh23 G T 10: 60,596,730 S138R possibly damaging Het
Cenpc1 T C 5: 86,037,755 H299R probably benign Het
Ciart A T 3: 95,878,701 M354K probably benign Het
Clasrp G T 7: 19,586,715 probably benign Het
Col4a3 G A 1: 82,696,319 G1132E unknown Het
Crebbp G A 16: 4,084,823 T2184I probably benign Het
Cyp7a1 C A 4: 6,275,492 R27M probably null Het
Ddhd2 A G 8: 25,752,165 F116L probably damaging Het
Dgkd G A 1: 87,927,691 R685K probably benign Het
Dnah2 A G 11: 69,524,240 S223P probably benign Het
Exph5 A T 9: 53,372,679 R353S possibly damaging Het
F11 C A 8: 45,252,118 V129F probably benign Het
F830045P16Rik A T 2: 129,459,397 S454T possibly damaging Het
Fam124a T C 14: 62,587,207 I50T probably damaging Het
Fam20c T C 5: 138,756,227 probably null Het
Fam234b A G 6: 135,226,914 T405A probably benign Het
Fbxo18 C A 2: 11,762,970 V356L possibly damaging Het
Flywch1 G A 17: 23,762,313 Q132* probably null Het
Foxo6 T C 4: 120,286,969 D95G probably benign Het
Ggt5 T C 10: 75,604,087 F174S probably damaging Het
Gm7104 G A 12: 88,285,781 noncoding transcript Het
Gpr155 A G 2: 73,373,633 L279P probably damaging Het
H2-T23 A G 17: 36,032,191 L98P probably damaging Het
Heatr5a A G 12: 51,955,403 V250A probably benign Het
Heyl A T 4: 123,241,363 I50F probably damaging Het
Hist4h4 G C 6: 136,804,103 R93G possibly damaging Het
Ifitm10 A T 7: 142,356,034 S179R probably damaging Het
Isg15 A T 4: 156,199,792 I93N probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itga10 G A 3: 96,657,690 V985I probably benign Het
Kcnt2 T C 1: 140,375,154 I144T probably benign Het
Klk1 A C 7: 44,229,034 K104T possibly damaging Het
Lemd3 C A 10: 120,933,442 R654L probably damaging Het
Lmod1 A T 1: 135,364,387 M327L probably benign Het
Lonrf2 T C 1: 38,807,050 E347G probably benign Het
Ltbp1 A G 17: 75,276,432 Y409C probably damaging Het
Mecom A T 3: 29,980,592 Y312N probably damaging Het
Mrgprb3 C T 7: 48,643,734 C23Y possibly damaging Het
Mut A G 17: 40,941,451 T295A probably benign Het
Nadk C A 4: 155,585,441 L194I probably damaging Het
Naxd A G 8: 11,509,510 I182V probably benign Het
Nbeal1 T A 1: 60,319,687 I1176K probably damaging Het
Nol4l C A 2: 153,529,521 R81L possibly damaging Het
Olfr1297 T A 2: 111,621,814 R87W probably benign Het
Olfr1411 G T 1: 92,596,969 R150L probably benign Het
Olfr957 A T 9: 39,511,378 M114K probably damaging Het
Pcdh18 A G 3: 49,754,940 V642A probably benign Het
Pdzk1 G A 3: 96,855,848 probably benign Het
Per3 C T 4: 151,033,938 V233I probably benign Het
Pisd G A 5: 32,764,796 P267S possibly damaging Het
Prm1 T A 16: 10,796,493 probably benign Het
Ptprj A G 2: 90,463,095 V548A probably damaging Het
Ranbp3 G A 17: 56,673,367 probably benign Het
Raver2 T A 4: 101,102,812 V163D probably damaging Het
Rbm14 A T 19: 4,803,877 I159N possibly damaging Het
Rfx6 G A 10: 51,718,126 V381I probably benign Het
Rhobtb1 T C 10: 69,272,863 probably benign Het
Rpl28-ps4 T A 6: 117,213,895 noncoding transcript Het
Rsph10b A G 5: 143,967,250 probably null Het
Rspo4 A G 2: 151,873,093 K217E unknown Het
Scgb2b27 G A 7: 34,013,285 A44V possibly damaging Het
Sec14l2 G A 11: 4,111,435 probably benign Het
Sec31b T C 19: 44,536,156 N101D probably benign Het
Sema6a A T 18: 47,306,429 C9* probably null Het
Sept5 A C 16: 18,623,012 L331R probably benign Het
Slc16a11 C A 11: 70,215,651 Y238* probably null Het
Slc25a12 T C 2: 71,312,548 T210A probably benign Het
Slc35f1 A T 10: 53,089,347 Y286F probably damaging Het
Szt2 A T 4: 118,376,448 L2225* probably null Het
Thap12 T C 7: 98,716,620 L665P probably damaging Het
Tpsb2 T A 17: 25,367,724 W237R probably damaging Het
Tyk2 T C 9: 21,120,341 D451G probably damaging Het
Ube2j1 T A 4: 33,049,696 N231K probably benign Het
Vmn1r225 A T 17: 20,502,590 T98S possibly damaging Het
Vmn1r87 A T 7: 13,131,821 S180T probably benign Het
Vmn2r6 A G 3: 64,537,841 V821A probably damaging Het
Zfp689 C A 7: 127,444,826 G211C probably damaging Het
Zfp827 A G 8: 79,076,236 D479G probably benign Het
Zfp995 A C 17: 21,880,594 F220V probably damaging Het
Other mutations in Cyp2r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Cyp2r1 APN 7 114551826 missense probably benign 0.00
IGL01515:Cyp2r1 APN 7 114552712 splice site probably benign
R0178:Cyp2r1 UTSW 7 114550408 missense probably damaging 1.00
R0518:Cyp2r1 UTSW 7 114552900 missense probably benign 0.01
R0686:Cyp2r1 UTSW 7 114552011 missense possibly damaging 0.52
R1772:Cyp2r1 UTSW 7 114553216 missense probably damaging 0.99
R3785:Cyp2r1 UTSW 7 114554696 missense possibly damaging 0.69
R6248:Cyp2r1 UTSW 7 114562731 critical splice donor site probably null
R6995:Cyp2r1 UTSW 7 114553081 missense probably damaging 1.00
R7048:Cyp2r1 UTSW 7 114552736 missense probably damaging 1.00
R7063:Cyp2r1 UTSW 7 114552949 missense probably damaging 1.00
R7538:Cyp2r1 UTSW 7 114562767 missense probably damaging 1.00
R7549:Cyp2r1 UTSW 7 114554644 missense possibly damaging 0.58
R7680:Cyp2r1 UTSW 7 114552819 missense probably damaging 1.00
R7882:Cyp2r1 UTSW 7 114554589 critical splice donor site probably null
R7965:Cyp2r1 UTSW 7 114554589 critical splice donor site probably null
R8054:Cyp2r1 UTSW 7 114552084 critical splice acceptor site unknown
Z1088:Cyp2r1 UTSW 7 114551974 missense probably damaging 1.00
Z1177:Cyp2r1 UTSW 7 114553339 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTTGGCCCAAACACCATTATTG -3'
(R):5'- CATTATGCAGAGAATTCAGAGATGG -3'

Sequencing Primer
(F):5'- GGCCCAAACACCATTATTGTGATTC -3'
(R):5'- CTTTGAGATTTGAGAAACTCCTCTC -3'
Posted On2014-08-25