Incidental Mutation 'R1976:Rab23'
ID221661
Institutional Source Beutler Lab
Gene Symbol Rab23
Ensembl Gene ENSMUSG00000004768
Gene NameRAB23, member RAS oncogene family
Synonyms
MMRRC Submission 039989-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1976 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location33719887-33742564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33723938 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 30 (C30S)
Ref Sequence ENSEMBL: ENSMUSP00000110828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088287] [ENSMUST00000115174] [ENSMUST00000138024]
Predicted Effect probably damaging
Transcript: ENSMUST00000088287
AA Change: C30S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000085625
Gene: ENSMUSG00000004768
AA Change: C30S

DomainStartEndE-ValueType
RAB 10 172 7.79e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115174
AA Change: C30S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110828
Gene: ENSMUSG00000004768
AA Change: C30S

DomainStartEndE-ValueType
RAB 10 172 7.79e-58 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135330
Predicted Effect possibly damaging
Transcript: ENSMUST00000138024
AA Change: C30S

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000137896
Gene: ENSMUSG00000004768
AA Change: C30S

DomainStartEndE-ValueType
Pfam:Miro 11 59 1.9e-6 PFAM
Pfam:Ras 11 61 6.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195006
Meta Mutation Damage Score 0.3614 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a small GTPase of the Ras superfamily. Rab proteins are involved in the regulation of diverse cellular functions associated with intracellular membrane trafficking, including autophagy and immune response to bacterial infection. The encoded protein may play a role in central nervous system development by antagonizing sonic hedgehog signaling. Disruption of this gene has been implicated in Carpenter syndrome as well as cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a spontaneous allele show neural tube defects, exencephaly, spinal cord and dorsal root ganglia anomalies, malformed eyes and defects in the axial skeleton and developing limbs. Mice homozygous for an ENU-induced allele die in utero with exencephaly, polydactyly and eye defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A C 7: 34,257,380 N353K probably damaging Het
Abca13 T C 11: 9,397,815 V3556A probably damaging Het
Abcb5 T C 12: 118,890,682 I833V probably benign Het
Adgrd1 A T 5: 129,140,797 H432L probably benign Het
Alppl2 T A 1: 87,088,741 I204F probably damaging Het
Ascc3 T A 10: 50,649,166 F486I probably damaging Het
Bcl9l T A 9: 44,506,152 L429Q possibly damaging Het
Ccdc33 A T 9: 58,117,162 Y227* probably null Het
Cd101 A G 3: 101,008,061 V730A probably damaging Het
Cdadc1 A T 14: 59,573,768 V431E probably damaging Het
Dazap1 T A 10: 80,274,620 probably null Het
Dbpht2 T A 12: 74,295,861 noncoding transcript Het
Dennd4b A T 3: 90,273,055 T742S probably damaging Het
Dhtkd1 T C 2: 5,902,391 E838G possibly damaging Het
Dync2h1 A T 9: 7,129,045 D1823E probably benign Het
Enox1 T A 14: 77,668,793 N556K probably benign Het
Fam227a T C 15: 79,626,276 I392M possibly damaging Het
Fnip2 A T 3: 79,480,931 M831K probably benign Het
Foxn1 T C 11: 78,365,937 probably benign Het
Glis3 T C 19: 28,262,677 probably benign Het
Gm4953 T A 1: 159,168,353 noncoding transcript Het
Gsr T G 8: 33,680,260 probably null Het
Habp4 G T 13: 64,184,606 V344F probably benign Het
Hdac7 G A 15: 97,806,505 Q495* probably null Het
Helb T C 10: 120,094,263 D737G possibly damaging Het
Hltf A G 3: 20,106,446 D759G probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Itsn2 A G 12: 4,672,733 probably benign Het
Kank2 A T 9: 21,794,561 V387E probably damaging Het
Lefty1 T C 1: 180,937,824 V319A probably benign Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Lpcat2b A T 5: 107,433,850 K348N possibly damaging Het
Lsamp T C 16: 41,889,067 V103A probably damaging Het
Ltbp4 A T 7: 27,326,770 C538S probably damaging Het
Micu1 T C 10: 59,768,213 S174P probably damaging Het
Mta1 A G 12: 113,136,306 N607S probably damaging Het
Muc5b C T 7: 141,863,154 S3279L probably benign Het
Naalad2 T C 9: 18,378,699 E211G probably damaging Het
Nup155 T A 15: 8,135,827 M649K probably benign Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Pisd A G 5: 32,738,865 V372A probably damaging Het
Prim1 T A 10: 128,023,799 C288S probably benign Het
Sacs A G 14: 61,202,895 T797A probably benign Het
Sall3 T C 18: 80,971,893 D940G probably benign Het
Scn1a T C 2: 66,331,271 E311G probably benign Het
Sdk1 T A 5: 142,143,818 I1598N probably damaging Het
Slc22a17 A T 14: 54,908,500 probably null Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Sprr3 T A 3: 92,456,946 Q197L possibly damaging Het
Stab2 A C 10: 86,896,496 probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tas2r123 T A 6: 132,847,332 V64D probably damaging Het
Trhde T G 10: 114,588,431 N483T possibly damaging Het
Trp53 C T 11: 69,588,497 T167M probably damaging Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Usp17la A G 7: 104,860,320 E44G possibly damaging Het
Usp40 T G 1: 87,978,536 Q659P probably benign Het
Vmn1r4 T C 6: 56,956,738 C76R probably damaging Het
Vmn2r118 C T 17: 55,592,925 G660R probably damaging Het
Zcchc11 T C 4: 108,479,523 L148P probably benign Het
Zfp786 T A 6: 47,819,757 H749L probably damaging Het
Other mutations in Rab23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02531:Rab23 APN 1 33738280 splice site probably benign
R0309:Rab23 UTSW 1 33734861 splice site probably null
R0798:Rab23 UTSW 1 33734827 missense probably damaging 0.99
R1549:Rab23 UTSW 1 33738297 missense possibly damaging 0.91
R1668:Rab23 UTSW 1 33734854 nonsense probably null
R2240:Rab23 UTSW 1 33739325 missense probably benign
R2866:Rab23 UTSW 1 33738295 missense possibly damaging 0.75
R4476:Rab23 UTSW 1 33724892 intron probably benign
R4614:Rab23 UTSW 1 33739385 missense probably benign 0.01
R5884:Rab23 UTSW 1 33724886 intron probably benign
R5939:Rab23 UTSW 1 33723909 missense probably damaging 1.00
R7567:Rab23 UTSW 1 33734731 missense possibly damaging 0.91
X0018:Rab23 UTSW 1 33738336 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCGATTACTGCAGTGCTGTG -3'
(R):5'- AGCTGTACATGAGCGTCTGC -3'

Sequencing Primer
(F):5'- CTGTGTGATTGTCTCTTGATAGAAAC -3'
(R):5'- TGCTACTCACTGGCTGGCATG -3'
Posted On2014-08-25