Incidental Mutation 'R2044:Ddhd2'
ID 221668
Institutional Source Beutler Lab
Gene Symbol Ddhd2
Ensembl Gene ENSMUSG00000061313
Gene Name DDHD domain containing 2
Synonyms 2010305K11Rik, SAMWD1
MMRRC Submission 040051-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock # R2044 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 25725346-25754596 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25752165 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 116 (F116L)
Ref Sequence ENSEMBL: ENSMUSP00000147769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033975] [ENSMUST00000211009] [ENSMUST00000211688] [ENSMUST00000211751]
AlphaFold Q80Y98
Predicted Effect probably damaging
Transcript: ENSMUST00000033975
AA Change: F116L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000033975
Gene: ENSMUSG00000061313
AA Change: F116L

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
Pfam:WWE 40 112 7.5e-9 PFAM
Blast:DDHD 285 357 6e-28 BLAST
SAM 382 447 1.13e-11 SMART
DDHD 484 688 6.63e-75 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167899
SMART Domains Protein: ENSMUSP00000130277
Gene: ENSMUSG00000091514

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209419
Predicted Effect unknown
Transcript: ENSMUST00000210888
AA Change: F98L
Predicted Effect probably damaging
Transcript: ENSMUST00000211009
AA Change: F116L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000211688
AA Change: F228L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000211751
Meta Mutation Damage Score 0.8425 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase enzyme containing sterile-alpha-motif (SAM), WWE, and DDHD domains. This protein participates in membrane trafficking between the endoplastic reticulum and the Golgi body. Mutations in this gene can cause autosomal recessive spastic paraplegia 54. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a null mutation display impaired balance and coordination, impaired spatial learning and memory and triglyceride accumulation in neurons in the brain and spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 36,978,094 probably benign Het
Abhd15 A G 11: 77,518,338 T293A probably benign Het
Aldh1l1 C T 6: 90,562,665 P192L probably benign Het
Aldoart1 T G 4: 72,852,542 I10L probably benign Het
Ankhd1 G A 18: 36,645,113 G1653D probably benign Het
Ankk1 A C 9: 49,419,364 probably null Het
Astn1 A G 1: 158,600,502 T748A possibly damaging Het
Bmp7 C A 2: 172,939,915 R52L possibly damaging Het
Ccdc151 T G 9: 21,991,858 T419P possibly damaging Het
Ccdc33 G A 9: 58,031,112 P859S possibly damaging Het
Ccny A G 18: 9,449,644 S10P probably damaging Het
Cdc6 C A 11: 98,910,461 F179L probably benign Het
Cdc7 T A 5: 106,983,132 V491E probably benign Het
Cdh23 G T 10: 60,596,730 S138R possibly damaging Het
Cenpc1 T C 5: 86,037,755 H299R probably benign Het
Ciart A T 3: 95,878,701 M354K probably benign Het
Clasrp G T 7: 19,586,715 probably benign Het
Col4a3 G A 1: 82,696,319 G1132E unknown Het
Crebbp G A 16: 4,084,823 T2184I probably benign Het
Cyp2r1 A C 7: 114,550,405 M458R probably damaging Het
Cyp7a1 C A 4: 6,275,492 R27M probably null Het
Dgkd G A 1: 87,927,691 R685K probably benign Het
Dnah2 A G 11: 69,524,240 S223P probably benign Het
Exph5 A T 9: 53,372,679 R353S possibly damaging Het
F11 C A 8: 45,252,118 V129F probably benign Het
F830045P16Rik A T 2: 129,459,397 S454T possibly damaging Het
Fam124a T C 14: 62,587,207 I50T probably damaging Het
Fam20c T C 5: 138,756,227 probably null Het
Fam234b A G 6: 135,226,914 T405A probably benign Het
Fbxo18 C A 2: 11,762,970 V356L possibly damaging Het
Flywch1 G A 17: 23,762,313 Q132* probably null Het
Foxo6 T C 4: 120,286,969 D95G probably benign Het
Ggt5 T C 10: 75,604,087 F174S probably damaging Het
Gm7104 G A 12: 88,285,781 noncoding transcript Het
Gpr155 A G 2: 73,373,633 L279P probably damaging Het
H2-T23 A G 17: 36,032,191 L98P probably damaging Het
Heatr5a A G 12: 51,955,403 V250A probably benign Het
Heyl A T 4: 123,241,363 I50F probably damaging Het
Hist4h4 G C 6: 136,804,103 R93G possibly damaging Het
Ifitm10 A T 7: 142,356,034 S179R probably damaging Het
Isg15 A T 4: 156,199,792 I93N probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itga10 G A 3: 96,657,690 V985I probably benign Het
Kcnt2 T C 1: 140,375,154 I144T probably benign Het
Klk1 A C 7: 44,229,034 K104T possibly damaging Het
Lemd3 C A 10: 120,933,442 R654L probably damaging Het
Lmod1 A T 1: 135,364,387 M327L probably benign Het
Lonrf2 T C 1: 38,807,050 E347G probably benign Het
Ltbp1 A G 17: 75,276,432 Y409C probably damaging Het
Mecom A T 3: 29,980,592 Y312N probably damaging Het
Mrgprb3 C T 7: 48,643,734 C23Y possibly damaging Het
Mut A G 17: 40,941,451 T295A probably benign Het
Nadk C A 4: 155,585,441 L194I probably damaging Het
Naxd A G 8: 11,509,510 I182V probably benign Het
Nbeal1 T A 1: 60,319,687 I1176K probably damaging Het
Nol4l C A 2: 153,529,521 R81L possibly damaging Het
Olfr1297 T A 2: 111,621,814 R87W probably benign Het
Olfr1411 G T 1: 92,596,969 R150L probably benign Het
Olfr957 A T 9: 39,511,378 M114K probably damaging Het
Pcdh18 A G 3: 49,754,940 V642A probably benign Het
Pdzk1 G A 3: 96,855,848 probably benign Het
Per3 C T 4: 151,033,938 V233I probably benign Het
Pisd G A 5: 32,764,796 P267S possibly damaging Het
Prm1 T A 16: 10,796,493 probably benign Het
Ptprj A G 2: 90,463,095 V548A probably damaging Het
Ranbp3 G A 17: 56,673,367 probably benign Het
Raver2 T A 4: 101,102,812 V163D probably damaging Het
Rbm14 A T 19: 4,803,877 I159N possibly damaging Het
Rfx6 G A 10: 51,718,126 V381I probably benign Het
Rhobtb1 T C 10: 69,272,863 probably benign Het
Rpl28-ps4 T A 6: 117,213,895 noncoding transcript Het
Rsph10b A G 5: 143,967,250 probably null Het
Rspo4 A G 2: 151,873,093 K217E unknown Het
Scgb2b27 G A 7: 34,013,285 A44V possibly damaging Het
Sec14l2 G A 11: 4,111,435 probably benign Het
Sec31b T C 19: 44,536,156 N101D probably benign Het
Sema6a A T 18: 47,306,429 C9* probably null Het
Sept5 A C 16: 18,623,012 L331R probably benign Het
Slc16a11 C A 11: 70,215,651 Y238* probably null Het
Slc25a12 T C 2: 71,312,548 T210A probably benign Het
Slc35f1 A T 10: 53,089,347 Y286F probably damaging Het
Szt2 A T 4: 118,376,448 L2225* probably null Het
Thap12 T C 7: 98,716,620 L665P probably damaging Het
Tpsb2 T A 17: 25,367,724 W237R probably damaging Het
Tyk2 T C 9: 21,120,341 D451G probably damaging Het
Ube2j1 T A 4: 33,049,696 N231K probably benign Het
Vmn1r225 A T 17: 20,502,590 T98S possibly damaging Het
Vmn1r87 A T 7: 13,131,821 S180T probably benign Het
Vmn2r6 A G 3: 64,537,841 V821A probably damaging Het
Zfp689 C A 7: 127,444,826 G211C probably damaging Het
Zfp827 A G 8: 79,076,236 D479G probably benign Het
Zfp995 A C 17: 21,880,594 F220V probably damaging Het
Other mutations in Ddhd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01501:Ddhd2 APN 8 25735830 missense probably damaging 1.00
IGL01629:Ddhd2 APN 8 25735828 missense possibly damaging 0.91
IGL01656:Ddhd2 APN 8 25727712 missense probably benign 0.34
IGL01723:Ddhd2 APN 8 25735011 nonsense probably null
IGL01820:Ddhd2 APN 8 25749754 missense possibly damaging 0.87
IGL01901:Ddhd2 APN 8 25748594 missense probably damaging 0.96
IGL02619:Ddhd2 APN 8 25746954 critical splice acceptor site probably null
PIT4362001:Ddhd2 UTSW 8 25735752 missense probably damaging 1.00
R0240:Ddhd2 UTSW 8 25739590 splice site probably null
R0240:Ddhd2 UTSW 8 25739590 splice site probably null
R0408:Ddhd2 UTSW 8 25739587 critical splice acceptor site probably null
R0732:Ddhd2 UTSW 8 25741321 missense probably damaging 1.00
R1483:Ddhd2 UTSW 8 25753128 missense probably benign 0.01
R1597:Ddhd2 UTSW 8 25749741 missense probably benign 0.09
R1881:Ddhd2 UTSW 8 25727700 missense probably damaging 0.99
R1927:Ddhd2 UTSW 8 25741661 missense possibly damaging 0.92
R4494:Ddhd2 UTSW 8 25738234 missense probably benign 0.01
R4728:Ddhd2 UTSW 8 25752267 missense probably damaging 1.00
R5044:Ddhd2 UTSW 8 25752137 missense probably damaging 1.00
R5138:Ddhd2 UTSW 8 25727699 missense probably damaging 1.00
R5529:Ddhd2 UTSW 8 25739560 missense probably benign 0.00
R5761:Ddhd2 UTSW 8 25741699 missense probably benign 0.19
R5799:Ddhd2 UTSW 8 25748602 missense probably damaging 1.00
R5934:Ddhd2 UTSW 8 25753113 missense probably damaging 1.00
R5965:Ddhd2 UTSW 8 25735777 missense probably damaging 1.00
R5988:Ddhd2 UTSW 8 25748562 missense probably damaging 1.00
R6260:Ddhd2 UTSW 8 25752117 missense probably benign 0.00
R6791:Ddhd2 UTSW 8 25752215 missense probably benign 0.04
R7386:Ddhd2 UTSW 8 25754290 missense possibly damaging 0.53
R7470:Ddhd2 UTSW 8 25735060 missense probably benign 0.06
R7911:Ddhd2 UTSW 8 25748536 critical splice donor site probably null
R8153:Ddhd2 UTSW 8 25750789 missense probably benign 0.16
R8385:Ddhd2 UTSW 8 25735014 missense probably damaging 0.99
R9190:Ddhd2 UTSW 8 25754467 missense probably benign 0.18
R9381:Ddhd2 UTSW 8 25749822 missense probably benign 0.17
R9497:Ddhd2 UTSW 8 25727704 missense possibly damaging 0.92
Z1176:Ddhd2 UTSW 8 25735829 missense possibly damaging 0.61
Z1177:Ddhd2 UTSW 8 25754374 missense probably benign
Z1177:Ddhd2 UTSW 8 25754385 missense unknown
Predicted Primers PCR Primer
(F):5'- TTTGAAACTAGCCTGCAGAGAG -3'
(R):5'- GCTGTTTTGGACTGTAACTTACAAG -3'

Sequencing Primer
(F):5'- ACTAGCCTGCAGAGAGAAATTAC -3'
(R):5'- GGACTGTAACTTACAAGTGTATTTGG -3'
Posted On 2014-08-25