Incidental Mutation 'R1976:Dhtkd1'
ID221673
Institutional Source Beutler Lab
Gene Symbol Dhtkd1
Ensembl Gene ENSMUSG00000025815
Gene Namedehydrogenase E1 and transketolase domain containing 1
SynonymsC330018I04Rik
MMRRC Submission 039989-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1976 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location5896115-5942792 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5902391 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 838 (E838G)
Ref Sequence ENSEMBL: ENSMUSP00000092769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026924] [ENSMUST00000095147]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026924
AA Change: E838G

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026924
Gene: ENSMUSG00000025815
AA Change: E838G

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 150 165 N/A INTRINSIC
Pfam:E1_dh 193 505 2.4e-44 PFAM
Blast:Transket_pyr 523 558 9e-8 BLAST
Transket_pyr 570 773 2.1e-54 SMART
Blast:Transket_pyr 775 805 7e-8 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000095147
AA Change: E838G

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000092769
Gene: ENSMUSG00000025815
AA Change: E838G

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 150 165 N/A INTRINSIC
Pfam:E1_dh 193 505 2.4e-44 PFAM
Blast:Transket_pyr 523 558 9e-8 BLAST
Transket_pyr 570 773 2.1e-54 SMART
Blast:Transket_pyr 775 805 7e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155977
Predicted Effect possibly damaging
Transcript: ENSMUST00000169865
AA Change: E838G

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129194
Gene: ENSMUSG00000025815
AA Change: E838G

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 150 165 N/A INTRINSIC
Pfam:E1_dh 193 505 1.7e-46 PFAM
Blast:Transket_pyr 523 558 9e-8 BLAST
Transket_pyr 570 773 2.1e-54 SMART
Pfam:OxoGdeHyase_C 777 919 2.2e-50 PFAM
Meta Mutation Damage Score 0.2614 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of a mitochondrial 2-oxoglutarate-dehydrogenase-complex-like protein involved in the degradation pathways of several amino acids, including lysine. Mutations in this gene are associated with 2-aminoadipic 2-oxoadipic aciduria and Charcot-Marie-Tooth Disease Type 2Q. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A C 7: 34,257,380 N353K probably damaging Het
Abca13 T C 11: 9,397,815 V3556A probably damaging Het
Abcb5 T C 12: 118,890,682 I833V probably benign Het
Adgrd1 A T 5: 129,140,797 H432L probably benign Het
Alppl2 T A 1: 87,088,741 I204F probably damaging Het
Ascc3 T A 10: 50,649,166 F486I probably damaging Het
Bcl9l T A 9: 44,506,152 L429Q possibly damaging Het
Ccdc33 A T 9: 58,117,162 Y227* probably null Het
Cd101 A G 3: 101,008,061 V730A probably damaging Het
Cdadc1 A T 14: 59,573,768 V431E probably damaging Het
Dazap1 T A 10: 80,274,620 probably null Het
Dbpht2 T A 12: 74,295,861 noncoding transcript Het
Dennd4b A T 3: 90,273,055 T742S probably damaging Het
Dync2h1 A T 9: 7,129,045 D1823E probably benign Het
Enox1 T A 14: 77,668,793 N556K probably benign Het
Fam227a T C 15: 79,626,276 I392M possibly damaging Het
Fnip2 A T 3: 79,480,931 M831K probably benign Het
Foxn1 T C 11: 78,365,937 probably benign Het
Glis3 T C 19: 28,262,677 probably benign Het
Gm4953 T A 1: 159,168,353 noncoding transcript Het
Gsr T G 8: 33,680,260 probably null Het
Habp4 G T 13: 64,184,606 V344F probably benign Het
Hdac7 G A 15: 97,806,505 Q495* probably null Het
Helb T C 10: 120,094,263 D737G possibly damaging Het
Hltf A G 3: 20,106,446 D759G probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Itsn2 A G 12: 4,672,733 probably benign Het
Kank2 A T 9: 21,794,561 V387E probably damaging Het
Lefty1 T C 1: 180,937,824 V319A probably benign Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Lpcat2b A T 5: 107,433,850 K348N possibly damaging Het
Lsamp T C 16: 41,889,067 V103A probably damaging Het
Ltbp4 A T 7: 27,326,770 C538S probably damaging Het
Micu1 T C 10: 59,768,213 S174P probably damaging Het
Mta1 A G 12: 113,136,306 N607S probably damaging Het
Muc5b C T 7: 141,863,154 S3279L probably benign Het
Naalad2 T C 9: 18,378,699 E211G probably damaging Het
Nup155 T A 15: 8,135,827 M649K probably benign Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Pisd A G 5: 32,738,865 V372A probably damaging Het
Prim1 T A 10: 128,023,799 C288S probably benign Het
Rab23 T A 1: 33,723,938 C30S probably damaging Het
Sacs A G 14: 61,202,895 T797A probably benign Het
Sall3 T C 18: 80,971,893 D940G probably benign Het
Scn1a T C 2: 66,331,271 E311G probably benign Het
Sdk1 T A 5: 142,143,818 I1598N probably damaging Het
Slc22a17 A T 14: 54,908,500 probably null Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Sprr3 T A 3: 92,456,946 Q197L possibly damaging Het
Stab2 A C 10: 86,896,496 probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tas2r123 T A 6: 132,847,332 V64D probably damaging Het
Trhde T G 10: 114,588,431 N483T possibly damaging Het
Trp53 C T 11: 69,588,497 T167M probably damaging Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Usp17la A G 7: 104,860,320 E44G possibly damaging Het
Usp40 T G 1: 87,978,536 Q659P probably benign Het
Vmn1r4 T C 6: 56,956,738 C76R probably damaging Het
Vmn2r118 C T 17: 55,592,925 G660R probably damaging Het
Zcchc11 T C 4: 108,479,523 L148P probably benign Het
Zfp786 T A 6: 47,819,757 H749L probably damaging Het
Other mutations in Dhtkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Dhtkd1 APN 2 5929657 missense probably damaging 1.00
IGL01544:Dhtkd1 APN 2 5913531 missense probably benign 0.00
IGL01724:Dhtkd1 APN 2 5914840 missense probably benign 0.00
IGL01726:Dhtkd1 APN 2 5942656 missense unknown
IGL02069:Dhtkd1 APN 2 5930934 nonsense probably null 0.00
IGL02476:Dhtkd1 APN 2 5930906 missense possibly damaging 0.89
IGL02662:Dhtkd1 APN 2 5899972 missense probably damaging 1.00
IGL02937:Dhtkd1 APN 2 5917905 missense possibly damaging 0.49
PIT4486001:Dhtkd1 UTSW 2 5899995 missense probably benign
R0277:Dhtkd1 UTSW 2 5914888 missense probably benign 0.00
R0323:Dhtkd1 UTSW 2 5914888 missense probably benign 0.00
R0373:Dhtkd1 UTSW 2 5911870 missense probably damaging 1.00
R0512:Dhtkd1 UTSW 2 5904091 missense probably damaging 1.00
R1497:Dhtkd1 UTSW 2 5904113 missense probably damaging 1.00
R1924:Dhtkd1 UTSW 2 5911933 missense probably damaging 1.00
R1943:Dhtkd1 UTSW 2 5932482 missense probably benign 0.11
R2057:Dhtkd1 UTSW 2 5942619 missense unknown
R5050:Dhtkd1 UTSW 2 5917689 missense probably benign 0.00
R5057:Dhtkd1 UTSW 2 5919513 missense probably damaging 1.00
R5133:Dhtkd1 UTSW 2 5904002 missense probably damaging 1.00
R5219:Dhtkd1 UTSW 2 5914816 missense probably benign 0.01
R5437:Dhtkd1 UTSW 2 5924119 missense probably benign 0.01
R5526:Dhtkd1 UTSW 2 5911851 missense probably damaging 1.00
R5720:Dhtkd1 UTSW 2 5903014 missense probably damaging 1.00
R6006:Dhtkd1 UTSW 2 5904025 nonsense probably null
R6155:Dhtkd1 UTSW 2 5910359 missense probably null 1.00
R6675:Dhtkd1 UTSW 2 5904078 missense probably damaging 1.00
R6870:Dhtkd1 UTSW 2 5919437 splice site probably null
R6899:Dhtkd1 UTSW 2 5917965 missense possibly damaging 0.91
R7123:Dhtkd1 UTSW 2 5917780 missense probably damaging 0.99
R7131:Dhtkd1 UTSW 2 5904070 missense probably benign 0.23
R7366:Dhtkd1 UTSW 2 5917906 missense probably benign 0.01
R7568:Dhtkd1 UTSW 2 5922087 intron probably null
R7731:Dhtkd1 UTSW 2 5924112 missense probably benign 0.07
R7874:Dhtkd1 UTSW 2 5917674 missense possibly damaging 0.72
R7957:Dhtkd1 UTSW 2 5917674 missense possibly damaging 0.72
Z1088:Dhtkd1 UTSW 2 5911874 missense possibly damaging 0.84
Z1177:Dhtkd1 UTSW 2 5942628 missense unknown
Predicted Primers PCR Primer
(F):5'- CCGTCTATAGCATGTCCTCAG -3'
(R):5'- CAGCTTTATCTGCAACACATTGAC -3'

Sequencing Primer
(F):5'- GCATGTCCTCAGATTTCATGAG -3'
(R):5'- TTATCTGCAACACATTGACATCTAG -3'
Posted On2014-08-25