Incidental Mutation 'R1976:Scn1a'
ID221675
Institutional Source Beutler Lab
Gene Symbol Scn1a
Ensembl Gene ENSMUSG00000064329
Gene Namesodium channel, voltage-gated, type I, alpha
SynonymsNav1.1
MMRRC Submission 039989-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1976 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location66270778-66440840 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66331271 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 311 (E311G)
Ref Sequence ENSEMBL: ENSMUSP00000116881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077489] [ENSMUST00000094951] [ENSMUST00000112366] [ENSMUST00000112371] [ENSMUST00000138910]
Predicted Effect probably benign
Transcript: ENSMUST00000077489
AA Change: E311G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000076697
Gene: ENSMUSG00000064329
AA Change: E311G

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.4e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 708 5.5e-73 PFAM
Pfam:Ion_trans 791 980 6.8e-47 PFAM
Pfam:Na_trans_assoc 995 1217 1.2e-74 PFAM
Pfam:Ion_trans 1243 1471 1.1e-56 PFAM
PDB:1BYY|A 1473 1525 4e-31 PDB
Pfam:Ion_trans 1564 1774 1.1e-51 PFAM
Pfam:PKD_channel 1623 1781 3.9e-7 PFAM
low complexity region 1826 1838 N/A INTRINSIC
IQ 1903 1925 1.65e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094951
AA Change: E311G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000092558
Gene: ENSMUSG00000064329
AA Change: E311G

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.3e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 691 2e-62 PFAM
Pfam:Ion_trans 774 963 6.7e-47 PFAM
Pfam:Na_trans_assoc 978 1200 1.2e-74 PFAM
Pfam:Ion_trans 1226 1454 1e-56 PFAM
PDB:1BYY|A 1456 1508 4e-31 PDB
Pfam:Ion_trans 1547 1757 1.1e-51 PFAM
Pfam:PKD_channel 1606 1764 3.8e-7 PFAM
low complexity region 1809 1821 N/A INTRINSIC
IQ 1886 1908 1.65e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112366
AA Change: E311G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000107985
Gene: ENSMUSG00000064329
AA Change: E311G

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 127 434 2.8e-82 PFAM
Pfam:Na_trans_cytopl 502 718 2e-91 PFAM
Pfam:Ion_trans 767 1002 6.5e-57 PFAM
Pfam:Na_trans_assoc 1006 1213 1.2e-60 PFAM
Pfam:Ion_trans 1217 1493 3.3e-67 PFAM
Pfam:Ion_trans 1540 1797 6.3e-56 PFAM
Pfam:PKD_channel 1637 1791 1.1e-6 PFAM
low complexity region 1837 1849 N/A INTRINSIC
IQ 1914 1936 1.65e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112371
AA Change: E311G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000107990
Gene: ENSMUSG00000064329
AA Change: E311G

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.4e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 708 5.5e-73 PFAM
Pfam:Ion_trans 791 980 6.8e-47 PFAM
Pfam:Na_trans_assoc 995 1217 1.2e-74 PFAM
Pfam:Ion_trans 1243 1471 1.1e-56 PFAM
PDB:1BYY|A 1473 1525 4e-31 PDB
Pfam:Ion_trans 1564 1774 1.1e-51 PFAM
Pfam:PKD_channel 1623 1781 3.9e-7 PFAM
low complexity region 1826 1838 N/A INTRINSIC
IQ 1903 1925 1.65e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138910
AA Change: E311G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000116881
Gene: ENSMUSG00000064329
AA Change: E311G

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Meta Mutation Damage Score 0.1983 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent sodium channels are heteromeric complexes that regulate sodium exchange between intracellular and extracellular spaces and are essential for the generation and propagation of action potentials in muscle cells and neurons. Each sodium channel is composed of a large pore-forming, glycosylated alpha subunit and two smaller beta subunits. This gene encodes a sodium channel alpha subunit, which has four homologous domains, each of which contains six transmembrane regions. Allelic variants of this gene are associated with generalized epilepsy with febrile seizures and epileptic encephalopathy. Alternative splicing results in multiple transcript variants. The RefSeq Project has decided to create four representative RefSeq records. Three of the transcript variants are supported by experimental evidence and the fourth contains alternate 5' untranslated exons, the exact combination of which have not been experimentally confirmed for the full-length transcript. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mice show postnatal lethality, seizures and behavioral deficits whereas heterozygotes die prematurely with seizures and abnormal electrophysiology. In addition, knock-in mice exhibit increased susceptibility to febrile and flurothyl-induced seizures, and reduced inhibitory signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A C 7: 34,257,380 N353K probably damaging Het
Abca13 T C 11: 9,397,815 V3556A probably damaging Het
Abcb5 T C 12: 118,890,682 I833V probably benign Het
Adgrd1 A T 5: 129,140,797 H432L probably benign Het
Alppl2 T A 1: 87,088,741 I204F probably damaging Het
Ascc3 T A 10: 50,649,166 F486I probably damaging Het
Bcl9l T A 9: 44,506,152 L429Q possibly damaging Het
Ccdc33 A T 9: 58,117,162 Y227* probably null Het
Cd101 A G 3: 101,008,061 V730A probably damaging Het
Cdadc1 A T 14: 59,573,768 V431E probably damaging Het
Dazap1 T A 10: 80,274,620 probably null Het
Dbpht2 T A 12: 74,295,861 noncoding transcript Het
Dennd4b A T 3: 90,273,055 T742S probably damaging Het
Dhtkd1 T C 2: 5,902,391 E838G possibly damaging Het
Dync2h1 A T 9: 7,129,045 D1823E probably benign Het
Enox1 T A 14: 77,668,793 N556K probably benign Het
Fam227a T C 15: 79,626,276 I392M possibly damaging Het
Fnip2 A T 3: 79,480,931 M831K probably benign Het
Foxn1 T C 11: 78,365,937 probably benign Het
Glis3 T C 19: 28,262,677 probably benign Het
Gm4953 T A 1: 159,168,353 noncoding transcript Het
Gsr T G 8: 33,680,260 probably null Het
Habp4 G T 13: 64,184,606 V344F probably benign Het
Hdac7 G A 15: 97,806,505 Q495* probably null Het
Helb T C 10: 120,094,263 D737G possibly damaging Het
Hltf A G 3: 20,106,446 D759G probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Itsn2 A G 12: 4,672,733 probably benign Het
Kank2 A T 9: 21,794,561 V387E probably damaging Het
Lefty1 T C 1: 180,937,824 V319A probably benign Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Lpcat2b A T 5: 107,433,850 K348N possibly damaging Het
Lsamp T C 16: 41,889,067 V103A probably damaging Het
Ltbp4 A T 7: 27,326,770 C538S probably damaging Het
Micu1 T C 10: 59,768,213 S174P probably damaging Het
Mta1 A G 12: 113,136,306 N607S probably damaging Het
Muc5b C T 7: 141,863,154 S3279L probably benign Het
Naalad2 T C 9: 18,378,699 E211G probably damaging Het
Nup155 T A 15: 8,135,827 M649K probably benign Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Pisd A G 5: 32,738,865 V372A probably damaging Het
Prim1 T A 10: 128,023,799 C288S probably benign Het
Rab23 T A 1: 33,723,938 C30S probably damaging Het
Sacs A G 14: 61,202,895 T797A probably benign Het
Sall3 T C 18: 80,971,893 D940G probably benign Het
Sdk1 T A 5: 142,143,818 I1598N probably damaging Het
Slc22a17 A T 14: 54,908,500 probably null Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Sprr3 T A 3: 92,456,946 Q197L possibly damaging Het
Stab2 A C 10: 86,896,496 probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tas2r123 T A 6: 132,847,332 V64D probably damaging Het
Trhde T G 10: 114,588,431 N483T possibly damaging Het
Trp53 C T 11: 69,588,497 T167M probably damaging Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Usp17la A G 7: 104,860,320 E44G possibly damaging Het
Usp40 T G 1: 87,978,536 Q659P probably benign Het
Vmn1r4 T C 6: 56,956,738 C76R probably damaging Het
Vmn2r118 C T 17: 55,592,925 G660R probably damaging Het
Zcchc11 T C 4: 108,479,523 L148P probably benign Het
Zfp786 T A 6: 47,819,757 H749L probably damaging Het
Other mutations in Scn1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Scn1a APN 2 66335531 critical splice acceptor site probably null
IGL00650:Scn1a APN 2 66280793 missense probably damaging 1.00
IGL00658:Scn1a APN 2 66286038 missense probably damaging 1.00
IGL00823:Scn1a APN 2 66324935 missense probably benign 0.04
IGL00907:Scn1a APN 2 66327797 missense probably damaging 1.00
IGL01339:Scn1a APN 2 66325960 missense probably benign 0.09
IGL01401:Scn1a APN 2 66289111 missense probably damaging 1.00
IGL01503:Scn1a APN 2 66322343 missense probably damaging 1.00
IGL01575:Scn1a APN 2 66273236 missense probably damaging 1.00
IGL01598:Scn1a APN 2 66302485 missense possibly damaging 0.63
IGL01613:Scn1a APN 2 66285937 missense probably damaging 1.00
IGL01796:Scn1a APN 2 66332301 splice site probably benign
IGL02079:Scn1a APN 2 66323360 missense probably benign 0.14
IGL02171:Scn1a APN 2 66273199 missense probably damaging 1.00
IGL02335:Scn1a APN 2 66277661 missense possibly damaging 0.93
IGL02406:Scn1a APN 2 66326036 missense possibly damaging 0.88
IGL02436:Scn1a APN 2 66351153 missense probably benign 0.01
IGL02507:Scn1a APN 2 66277813 missense probably damaging 1.00
IGL02646:Scn1a APN 2 66299618 splice site probably null
IGL02729:Scn1a APN 2 66299650 missense probably damaging 1.00
IGL02740:Scn1a APN 2 66324762 missense probably damaging 1.00
IGL02740:Scn1a APN 2 66318077 missense probably benign 0.00
IGL02752:Scn1a APN 2 66331412 missense probably damaging 1.00
IGL02815:Scn1a APN 2 66324858 missense probably damaging 1.00
IGL03163:Scn1a APN 2 66318074 missense probably benign 0.00
IGL03229:Scn1a APN 2 66299713 missense probably damaging 1.00
IGL03286:Scn1a APN 2 66277576 missense probably damaging 0.99
IGL03393:Scn1a APN 2 66318018 missense probably benign 0.19
palsy UTSW 2 66277656 intron probably null
PIT4791001:Scn1a UTSW 2 66273282 missense probably benign 0.18
R0053:Scn1a UTSW 2 66299775 missense probably benign 0.05
R0053:Scn1a UTSW 2 66299775 missense probably benign 0.05
R0107:Scn1a UTSW 2 66324633 missense probably benign 0.07
R0141:Scn1a UTSW 2 66289062 missense probably damaging 1.00
R0485:Scn1a UTSW 2 66273925 missense probably damaging 0.98
R0517:Scn1a UTSW 2 66302407 missense possibly damaging 0.88
R0532:Scn1a UTSW 2 66317823 missense probably damaging 1.00
R0746:Scn1a UTSW 2 66351126 missense probably benign 0.25
R0755:Scn1a UTSW 2 66321035 missense probably damaging 1.00
R0830:Scn1a UTSW 2 66299784 missense probably damaging 1.00
R0846:Scn1a UTSW 2 66324755 missense probably benign 0.43
R0918:Scn1a UTSW 2 66323307 splice site probably null
R1055:Scn1a UTSW 2 66337996 missense probably benign 0.08
R1432:Scn1a UTSW 2 66322429 missense probably damaging 1.00
R1497:Scn1a UTSW 2 66332287 missense probably damaging 1.00
R1512:Scn1a UTSW 2 66331285 missense possibly damaging 0.82
R1525:Scn1a UTSW 2 66319462 nonsense probably null
R1567:Scn1a UTSW 2 66273331 missense probably damaging 1.00
R1702:Scn1a UTSW 2 66318223 missense probably damaging 1.00
R1744:Scn1a UTSW 2 66322276 missense probably benign 0.06
R1834:Scn1a UTSW 2 66324616 missense probably benign 0.04
R1834:Scn1a UTSW 2 66324617 missense probably benign 0.00
R1860:Scn1a UTSW 2 66317982 missense probably damaging 0.99
R1871:Scn1a UTSW 2 66318025 missense probably damaging 0.98
R1909:Scn1a UTSW 2 66331352 missense possibly damaging 0.58
R1967:Scn1a UTSW 2 66328425 missense probably damaging 1.00
R2291:Scn1a UTSW 2 66288968 missense probably benign 0.44
R2302:Scn1a UTSW 2 66277745 missense probably damaging 1.00
R2367:Scn1a UTSW 2 66327679 missense probably damaging 1.00
R2418:Scn1a UTSW 2 66273843 missense probably damaging 0.98
R2517:Scn1a UTSW 2 66273832 missense probably damaging 1.00
R2568:Scn1a UTSW 2 66273469 missense probably damaging 1.00
R3083:Scn1a UTSW 2 66299637 missense probably damaging 1.00
R3903:Scn1a UTSW 2 66318132 missense probably benign 0.08
R3909:Scn1a UTSW 2 66273988 missense probably damaging 1.00
R3916:Scn1a UTSW 2 66277613 missense probably damaging 1.00
R3935:Scn1a UTSW 2 66327776 missense probably damaging 0.99
R3936:Scn1a UTSW 2 66327776 missense probably damaging 0.99
R4043:Scn1a UTSW 2 66326036 missense possibly damaging 0.60
R4429:Scn1a UTSW 2 66350985 missense possibly damaging 0.77
R4495:Scn1a UTSW 2 66280802 critical splice acceptor site probably null
R4662:Scn1a UTSW 2 66350988 missense probably benign 0.23
R4834:Scn1a UTSW 2 66328522 nonsense probably null
R4873:Scn1a UTSW 2 66328476 missense possibly damaging 0.92
R4875:Scn1a UTSW 2 66328476 missense possibly damaging 0.92
R5099:Scn1a UTSW 2 66277801 missense probably damaging 1.00
R5255:Scn1a UTSW 2 66277669 missense probably damaging 0.99
R5435:Scn1a UTSW 2 66273534 missense probably damaging 1.00
R5449:Scn1a UTSW 2 66321002 missense probably damaging 0.96
R5519:Scn1a UTSW 2 66332213 missense probably damaging 1.00
R5541:Scn1a UTSW 2 66324633 missense probably benign 0.07
R5556:Scn1a UTSW 2 66324797 missense probably benign 0.00
R5587:Scn1a UTSW 2 66273081 missense probably benign 0.01
R5972:Scn1a UTSW 2 66351110 missense possibly damaging 0.65
R5992:Scn1a UTSW 2 66335456 missense probably damaging 1.00
R6195:Scn1a UTSW 2 66277618 missense possibly damaging 0.59
R6233:Scn1a UTSW 2 66277618 missense possibly damaging 0.59
R6328:Scn1a UTSW 2 66273316 missense probably damaging 1.00
R6417:Scn1a UTSW 2 66273198 missense probably damaging 1.00
R6420:Scn1a UTSW 2 66273198 missense probably damaging 1.00
R6421:Scn1a UTSW 2 66272927 missense probably damaging 1.00
R6461:Scn1a UTSW 2 66326122 missense probably null 0.01
R6701:Scn1a UTSW 2 66337960 missense probably damaging 0.99
R6717:Scn1a UTSW 2 66332287 missense probably damaging 1.00
R6834:Scn1a UTSW 2 66327742 missense probably damaging 1.00
R6918:Scn1a UTSW 2 66332213 missense probably damaging 1.00
R6953:Scn1a UTSW 2 66319469 missense probably damaging 1.00
R6996:Scn1a UTSW 2 66287731 missense probably damaging 1.00
R7022:Scn1a UTSW 2 66317899 missense probably damaging 1.00
R7109:Scn1a UTSW 2 66350942 missense possibly damaging 0.62
R7115:Scn1a UTSW 2 66324618 nonsense probably null
R7239:Scn1a UTSW 2 66277656 intron probably null
R7434:Scn1a UTSW 2 66273045 missense probably benign
R7646:Scn1a UTSW 2 66287758 missense possibly damaging 0.93
R7711:Scn1a UTSW 2 66303660 missense probably benign
R7879:Scn1a UTSW 2 66286005 nonsense probably null
R7962:Scn1a UTSW 2 66286005 nonsense probably null
R8025:Scn1a UTSW 2 66318213 missense probably benign 0.02
R8055:Scn1a UTSW 2 66319501 missense probably damaging 1.00
Z1176:Scn1a UTSW 2 66326128 missense possibly damaging 0.92
Z1177:Scn1a UTSW 2 66324952 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACTAGTCAGAGGGCAGACTG -3'
(R):5'- TGACGTCATGATACTCACTGTGTTC -3'

Sequencing Primer
(F):5'- CAGACTGGAAGTGGGATAATGACTG -3'
(R):5'- ATGATACTCACTGTGTTCTGTCTCAG -3'
Posted On2014-08-25