Incidental Mutation 'R2044:Ccdc151'
ID 221676
Institutional Source Beutler Lab
Gene Symbol Ccdc151
Ensembl Gene ENSMUSG00000039632
Gene Name coiled-coil domain containing 151
Synonyms
MMRRC Submission 040051-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock # R2044 (G1)
Quality Score 170
Status Validated
Chromosome 9
Chromosomal Location 21989871-22002634 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 21991858 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 419 (T419P)
Ref Sequence ENSEMBL: ENSMUSP00000041117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044926] [ENSMUST00000045726] [ENSMUST00000115336] [ENSMUST00000214026] [ENSMUST00000215851]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000044926
AA Change: T419P

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041117
Gene: ENSMUSG00000039632
AA Change: T419P

DomainStartEndE-ValueType
coiled coil region 88 286 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
coiled coil region 378 420 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 550 565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045726
SMART Domains Protein: ENSMUSP00000035726
Gene: ENSMUSG00000040146

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
RasGEFN 63 201 1.35e-6 SMART
RasGEF 244 504 2.74e-84 SMART
low complexity region 533 579 N/A INTRINSIC
RA 609 699 3.36e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115336
AA Change: T420P

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110993
Gene: ENSMUSG00000039632
AA Change: T420P

DomainStartEndE-ValueType
coiled coil region 88 286 N/A INTRINSIC
low complexity region 335 346 N/A INTRINSIC
coiled coil region 379 421 N/A INTRINSIC
low complexity region 496 515 N/A INTRINSIC
low complexity region 551 566 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214713
Predicted Effect probably benign
Transcript: ENSMUST00000215851
Meta Mutation Damage Score 0.0987 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing coiled-coil domains. The encoded protein functions in outer dynein arm assembly and is required for motile cilia function. Mutations in this gene result in primary ciliary dyskinesia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mico homozygous for an ENU-induced allele exhibit dextrocardia associated with situs inversus totalis and hypoplastic spleen, adrenal anomalies and immotile/dyskinetic tracheal airway cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 36,978,094 probably benign Het
Abhd15 A G 11: 77,518,338 T293A probably benign Het
Aldh1l1 C T 6: 90,562,665 P192L probably benign Het
Aldoart1 T G 4: 72,852,542 I10L probably benign Het
Ankhd1 G A 18: 36,645,113 G1653D probably benign Het
Ankk1 A C 9: 49,419,364 probably null Het
Astn1 A G 1: 158,600,502 T748A possibly damaging Het
Bmp7 C A 2: 172,939,915 R52L possibly damaging Het
Ccdc33 G A 9: 58,031,112 P859S possibly damaging Het
Ccny A G 18: 9,449,644 S10P probably damaging Het
Cdc6 C A 11: 98,910,461 F179L probably benign Het
Cdc7 T A 5: 106,983,132 V491E probably benign Het
Cdh23 G T 10: 60,596,730 S138R possibly damaging Het
Cenpc1 T C 5: 86,037,755 H299R probably benign Het
Ciart A T 3: 95,878,701 M354K probably benign Het
Clasrp G T 7: 19,586,715 probably benign Het
Col4a3 G A 1: 82,696,319 G1132E unknown Het
Crebbp G A 16: 4,084,823 T2184I probably benign Het
Cyp2r1 A C 7: 114,550,405 M458R probably damaging Het
Cyp7a1 C A 4: 6,275,492 R27M probably null Het
Ddhd2 A G 8: 25,752,165 F116L probably damaging Het
Dgkd G A 1: 87,927,691 R685K probably benign Het
Dnah2 A G 11: 69,524,240 S223P probably benign Het
Exph5 A T 9: 53,372,679 R353S possibly damaging Het
F11 C A 8: 45,252,118 V129F probably benign Het
F830045P16Rik A T 2: 129,459,397 S454T possibly damaging Het
Fam124a T C 14: 62,587,207 I50T probably damaging Het
Fam20c T C 5: 138,756,227 probably null Het
Fam234b A G 6: 135,226,914 T405A probably benign Het
Fbxo18 C A 2: 11,762,970 V356L possibly damaging Het
Flywch1 G A 17: 23,762,313 Q132* probably null Het
Foxo6 T C 4: 120,286,969 D95G probably benign Het
Ggt5 T C 10: 75,604,087 F174S probably damaging Het
Gm7104 G A 12: 88,285,781 noncoding transcript Het
Gpr155 A G 2: 73,373,633 L279P probably damaging Het
H2-T23 A G 17: 36,032,191 L98P probably damaging Het
Heatr5a A G 12: 51,955,403 V250A probably benign Het
Heyl A T 4: 123,241,363 I50F probably damaging Het
Hist4h4 G C 6: 136,804,103 R93G possibly damaging Het
Ifitm10 A T 7: 142,356,034 S179R probably damaging Het
Isg15 A T 4: 156,199,792 I93N probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itga10 G A 3: 96,657,690 V985I probably benign Het
Kcnt2 T C 1: 140,375,154 I144T probably benign Het
Klk1 A C 7: 44,229,034 K104T possibly damaging Het
Lemd3 C A 10: 120,933,442 R654L probably damaging Het
Lmod1 A T 1: 135,364,387 M327L probably benign Het
Lonrf2 T C 1: 38,807,050 E347G probably benign Het
Ltbp1 A G 17: 75,276,432 Y409C probably damaging Het
Mecom A T 3: 29,980,592 Y312N probably damaging Het
Mrgprb3 C T 7: 48,643,734 C23Y possibly damaging Het
Mut A G 17: 40,941,451 T295A probably benign Het
Nadk C A 4: 155,585,441 L194I probably damaging Het
Naxd A G 8: 11,509,510 I182V probably benign Het
Nbeal1 T A 1: 60,319,687 I1176K probably damaging Het
Nol4l C A 2: 153,529,521 R81L possibly damaging Het
Olfr1297 T A 2: 111,621,814 R87W probably benign Het
Olfr1411 G T 1: 92,596,969 R150L probably benign Het
Olfr957 A T 9: 39,511,378 M114K probably damaging Het
Pcdh18 A G 3: 49,754,940 V642A probably benign Het
Pdzk1 G A 3: 96,855,848 probably benign Het
Per3 C T 4: 151,033,938 V233I probably benign Het
Pisd G A 5: 32,764,796 P267S possibly damaging Het
Prm1 T A 16: 10,796,493 probably benign Het
Ptprj A G 2: 90,463,095 V548A probably damaging Het
Ranbp3 G A 17: 56,673,367 probably benign Het
Raver2 T A 4: 101,102,812 V163D probably damaging Het
Rbm14 A T 19: 4,803,877 I159N possibly damaging Het
Rfx6 G A 10: 51,718,126 V381I probably benign Het
Rhobtb1 T C 10: 69,272,863 probably benign Het
Rpl28-ps4 T A 6: 117,213,895 noncoding transcript Het
Rsph10b A G 5: 143,967,250 probably null Het
Rspo4 A G 2: 151,873,093 K217E unknown Het
Scgb2b27 G A 7: 34,013,285 A44V possibly damaging Het
Sec14l2 G A 11: 4,111,435 probably benign Het
Sec31b T C 19: 44,536,156 N101D probably benign Het
Sema6a A T 18: 47,306,429 C9* probably null Het
Sept5 A C 16: 18,623,012 L331R probably benign Het
Slc16a11 C A 11: 70,215,651 Y238* probably null Het
Slc25a12 T C 2: 71,312,548 T210A probably benign Het
Slc35f1 A T 10: 53,089,347 Y286F probably damaging Het
Szt2 A T 4: 118,376,448 L2225* probably null Het
Thap12 T C 7: 98,716,620 L665P probably damaging Het
Tpsb2 T A 17: 25,367,724 W237R probably damaging Het
Tyk2 T C 9: 21,120,341 D451G probably damaging Het
Ube2j1 T A 4: 33,049,696 N231K probably benign Het
Vmn1r225 A T 17: 20,502,590 T98S possibly damaging Het
Vmn1r87 A T 7: 13,131,821 S180T probably benign Het
Vmn2r6 A G 3: 64,537,841 V821A probably damaging Het
Zfp689 C A 7: 127,444,826 G211C probably damaging Het
Zfp827 A G 8: 79,076,236 D479G probably benign Het
Zfp995 A C 17: 21,880,594 F220V probably damaging Het
Other mutations in Ccdc151
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Ccdc151 APN 9 21995379 critical splice acceptor site probably null
IGL01922:Ccdc151 APN 9 21993530 unclassified probably benign
IGL02223:Ccdc151 APN 9 21993612 missense probably damaging 1.00
IGL03161:Ccdc151 APN 9 22002315 missense probably benign 0.02
IGL03269:Ccdc151 APN 9 21998043 critical splice donor site probably null
R0118:Ccdc151 UTSW 9 21995057 missense probably benign 0.03
R0129:Ccdc151 UTSW 9 21993552 missense probably damaging 0.98
R0279:Ccdc151 UTSW 9 21990247 unclassified probably benign
R0390:Ccdc151 UTSW 9 21991708 missense probably benign 0.00
R1349:Ccdc151 UTSW 9 21993620 missense probably damaging 1.00
R1372:Ccdc151 UTSW 9 21993620 missense probably damaging 1.00
R1891:Ccdc151 UTSW 9 21995381 splice site probably null
R5116:Ccdc151 UTSW 9 21990128 makesense probably null
R5147:Ccdc151 UTSW 9 21994862 missense probably benign 0.21
R5929:Ccdc151 UTSW 9 22002422 missense possibly damaging 0.50
R6182:Ccdc151 UTSW 9 21990402 missense probably damaging 1.00
R7253:Ccdc151 UTSW 9 22002471 missense probably damaging 1.00
R7498:Ccdc151 UTSW 9 22002257 missense probably damaging 1.00
R7742:Ccdc151 UTSW 9 21992897 missense possibly damaging 0.82
R8331:Ccdc151 UTSW 9 21991711 missense probably damaging 1.00
R8976:Ccdc151 UTSW 9 21992038 unclassified probably benign
R9319:Ccdc151 UTSW 9 21994907 missense probably damaging 1.00
R9324:Ccdc151 UTSW 9 21991911 missense probably damaging 1.00
R9422:Ccdc151 UTSW 9 22002332 missense possibly damaging 0.55
R9614:Ccdc151 UTSW 9 21993014 missense probably benign 0.02
Z1176:Ccdc151 UTSW 9 21990424 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TCCAGTCTCTCGTGGACATC -3'
(R):5'- TCCTCATACATTGTTGTGTGACAG -3'

Sequencing Primer
(F):5'- GACATCATTGTGACGCTGC -3'
(R):5'- AGAGGACCATAGTGTCCTCG -3'
Posted On 2014-08-25