Incidental Mutation 'R2044:Or8g36'
ID 221677
Institutional Source Beutler Lab
Gene Symbol Or8g36
Ensembl Gene ENSMUSG00000095322
Gene Name olfactory receptor family 8 subfamily G member 36
Synonyms Olfr957, MOR171-12, GA_x6K02T2PVTD-33208209-33207274
MMRRC Submission 040051-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R2044 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 39422079-39423014 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 39422674 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 114 (M114K)
Ref Sequence ENSEMBL: ENSMUSP00000149559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051653] [ENSMUST00000216177]
AlphaFold Q9EQB7
Predicted Effect probably damaging
Transcript: ENSMUST00000051653
AA Change: M114K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000054536
Gene: ENSMUSG00000095322
AA Change: M114K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-50 PFAM
Pfam:7tm_1 41 290 3.8e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216177
AA Change: M114K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 37,288,986 (GRCm39) probably benign Het
Abhd15 A G 11: 77,409,164 (GRCm39) T293A probably benign Het
Aldh1l1 C T 6: 90,539,647 (GRCm39) P192L probably benign Het
Aldoart1 T G 4: 72,770,779 (GRCm39) I10L probably benign Het
Ankhd1 G A 18: 36,778,166 (GRCm39) G1653D probably benign Het
Ankk1 A C 9: 49,330,664 (GRCm39) probably null Het
Astn1 A G 1: 158,428,072 (GRCm39) T748A possibly damaging Het
Bmp7 C A 2: 172,781,708 (GRCm39) R52L possibly damaging Het
Ccdc33 G A 9: 57,938,395 (GRCm39) P859S possibly damaging Het
Ccny A G 18: 9,449,644 (GRCm39) S10P probably damaging Het
Cdc6 C A 11: 98,801,287 (GRCm39) F179L probably benign Het
Cdc7 T A 5: 107,130,998 (GRCm39) V491E probably benign Het
Cdh23 G T 10: 60,432,509 (GRCm39) S138R possibly damaging Het
Cenpc1 T C 5: 86,185,614 (GRCm39) H299R probably benign Het
Ciart A T 3: 95,786,013 (GRCm39) M354K probably benign Het
Clasrp G T 7: 19,320,640 (GRCm39) probably benign Het
Col4a3 G A 1: 82,674,040 (GRCm39) G1132E unknown Het
Crebbp G A 16: 3,902,687 (GRCm39) T2184I probably benign Het
Cyp2r1 A C 7: 114,149,640 (GRCm39) M458R probably damaging Het
Cyp7a1 C A 4: 6,275,492 (GRCm39) R27M probably null Het
Ddhd2 A G 8: 26,242,192 (GRCm39) F116L probably damaging Het
Dgkd G A 1: 87,855,413 (GRCm39) R685K probably benign Het
Dnah2 A G 11: 69,415,066 (GRCm39) S223P probably benign Het
Exph5 A T 9: 53,283,979 (GRCm39) R353S possibly damaging Het
F11 C A 8: 45,705,155 (GRCm39) V129F probably benign Het
F830045P16Rik A T 2: 129,301,317 (GRCm39) S454T possibly damaging Het
Fam124a T C 14: 62,824,656 (GRCm39) I50T probably damaging Het
Fam20c T C 5: 138,741,982 (GRCm39) probably null Het
Fam234b A G 6: 135,203,912 (GRCm39) T405A probably benign Het
Fbh1 C A 2: 11,767,781 (GRCm39) V356L possibly damaging Het
Flywch1 G A 17: 23,981,287 (GRCm39) Q132* probably null Het
Foxo6 T C 4: 120,144,166 (GRCm39) D95G probably benign Het
Ggt5 T C 10: 75,439,921 (GRCm39) F174S probably damaging Het
Gm7104 G A 12: 88,252,551 (GRCm39) noncoding transcript Het
Gpr155 A G 2: 73,203,977 (GRCm39) L279P probably damaging Het
H2-T23 A G 17: 36,343,083 (GRCm39) L98P probably damaging Het
H4c16 G C 6: 136,781,101 (GRCm39) R93G possibly damaging Het
Heatr5a A G 12: 52,002,186 (GRCm39) V250A probably benign Het
Heyl A T 4: 123,135,156 (GRCm39) I50F probably damaging Het
Ifitm10 A T 7: 141,909,771 (GRCm39) S179R probably damaging Het
Isg15 A T 4: 156,284,249 (GRCm39) I93N probably benign Het
Itga10 C T 3: 96,559,054 (GRCm39) probably benign Het
Itga10 G A 3: 96,565,006 (GRCm39) V985I probably benign Het
Kcnt2 T C 1: 140,302,892 (GRCm39) I144T probably benign Het
Klk1 A C 7: 43,878,458 (GRCm39) K104T possibly damaging Het
Lemd3 C A 10: 120,769,347 (GRCm39) R654L probably damaging Het
Lmod1 A T 1: 135,292,125 (GRCm39) M327L probably benign Het
Lonrf2 T C 1: 38,846,131 (GRCm39) E347G probably benign Het
Ltbp1 A G 17: 75,583,427 (GRCm39) Y409C probably damaging Het
Mecom A T 3: 30,034,741 (GRCm39) Y312N probably damaging Het
Mmut A G 17: 41,252,342 (GRCm39) T295A probably benign Het
Mrgprb3 C T 7: 48,293,482 (GRCm39) C23Y possibly damaging Het
Nadk C A 4: 155,669,898 (GRCm39) L194I probably damaging Het
Naxd A G 8: 11,559,510 (GRCm39) I182V probably benign Het
Nbeal1 T A 1: 60,358,846 (GRCm39) I1176K probably damaging Het
Nol4l C A 2: 153,371,441 (GRCm39) R81L possibly damaging Het
Odad3 T G 9: 21,903,154 (GRCm39) T419P possibly damaging Het
Or4k47 T A 2: 111,452,159 (GRCm39) R87W probably benign Het
Or9s15 G T 1: 92,524,691 (GRCm39) R150L probably benign Het
Pcdh18 A G 3: 49,709,389 (GRCm39) V642A probably benign Het
Pdzk1 G A 3: 96,763,164 (GRCm39) probably benign Het
Per3 C T 4: 151,118,395 (GRCm39) V233I probably benign Het
Pisd G A 5: 32,922,140 (GRCm39) P267S possibly damaging Het
Prm1 T A 16: 10,614,357 (GRCm39) probably benign Het
Ptprj A G 2: 90,293,439 (GRCm39) V548A probably damaging Het
Ranbp3 G A 17: 56,980,367 (GRCm39) probably benign Het
Raver2 T A 4: 100,960,009 (GRCm39) V163D probably damaging Het
Rbm14 A T 19: 4,853,905 (GRCm39) I159N possibly damaging Het
Rfx6 G A 10: 51,594,222 (GRCm39) V381I probably benign Het
Rhobtb1 T C 10: 69,108,693 (GRCm39) probably benign Het
Rpl28-ps4 T A 6: 117,190,856 (GRCm39) noncoding transcript Het
Rsph10b A G 5: 143,904,068 (GRCm39) probably null Het
Rspo4 A G 2: 151,715,013 (GRCm39) K217E unknown Het
Scgb2b27 G A 7: 33,712,710 (GRCm39) A44V possibly damaging Het
Sec14l2 G A 11: 4,061,435 (GRCm39) probably benign Het
Sec31b T C 19: 44,524,595 (GRCm39) N101D probably benign Het
Sema6a A T 18: 47,439,496 (GRCm39) C9* probably null Het
Septin5 A C 16: 18,441,762 (GRCm39) L331R probably benign Het
Slc16a11 C A 11: 70,106,477 (GRCm39) Y238* probably null Het
Slc25a12 T C 2: 71,142,892 (GRCm39) T210A probably benign Het
Slc35f1 A T 10: 52,965,443 (GRCm39) Y286F probably damaging Het
Szt2 A T 4: 118,233,645 (GRCm39) L2225* probably null Het
Thap12 T C 7: 98,365,827 (GRCm39) L665P probably damaging Het
Tpsb2 T A 17: 25,586,698 (GRCm39) W237R probably damaging Het
Tyk2 T C 9: 21,031,637 (GRCm39) D451G probably damaging Het
Ube2j1 T A 4: 33,049,696 (GRCm39) N231K probably benign Het
Vmn1r225 A T 17: 20,722,852 (GRCm39) T98S possibly damaging Het
Vmn1r87 A T 7: 12,865,748 (GRCm39) S180T probably benign Het
Vmn2r6 A G 3: 64,445,262 (GRCm39) V821A probably damaging Het
Zfp689 C A 7: 127,043,998 (GRCm39) G211C probably damaging Het
Zfp827 A G 8: 79,802,865 (GRCm39) D479G probably benign Het
Zfp995 A C 17: 22,099,575 (GRCm39) F220V probably damaging Het
Other mutations in Or8g36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Or8g36 APN 9 39,422,342 (GRCm39) missense possibly damaging 0.64
R0603:Or8g36 UTSW 9 39,422,810 (GRCm39) missense possibly damaging 0.76
R1642:Or8g36 UTSW 9 39,422,650 (GRCm39) missense possibly damaging 0.78
R2182:Or8g36 UTSW 9 39,422,722 (GRCm39) missense probably damaging 1.00
R2290:Or8g36 UTSW 9 39,422,974 (GRCm39) missense possibly damaging 0.87
R4246:Or8g36 UTSW 9 39,422,899 (GRCm39) missense probably benign 0.31
R4248:Or8g36 UTSW 9 39,422,899 (GRCm39) missense probably benign 0.31
R5273:Or8g36 UTSW 9 39,422,795 (GRCm39) missense possibly damaging 0.95
R5495:Or8g36 UTSW 9 39,422,441 (GRCm39) missense probably benign 0.39
R5718:Or8g36 UTSW 9 39,422,338 (GRCm39) missense probably damaging 1.00
R5827:Or8g36 UTSW 9 39,422,354 (GRCm39) missense probably damaging 1.00
R6261:Or8g36 UTSW 9 39,422,105 (GRCm39) missense probably benign
R6917:Or8g36 UTSW 9 39,422,495 (GRCm39) missense probably damaging 1.00
R7965:Or8g36 UTSW 9 39,422,810 (GRCm39) missense probably benign 0.00
R8357:Or8g36 UTSW 9 39,422,442 (GRCm39) missense probably benign 0.38
R8457:Or8g36 UTSW 9 39,422,442 (GRCm39) missense probably benign 0.38
R8896:Or8g36 UTSW 9 39,422,770 (GRCm39) missense probably damaging 1.00
R8938:Or8g36 UTSW 9 39,422,910 (GRCm39) nonsense probably null
R9249:Or8g36 UTSW 9 39,422,149 (GRCm39) missense probably damaging 1.00
R9629:Or8g36 UTSW 9 39,422,497 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGCAGAAAAGCAGTCTAAGC -3'
(R):5'- TCACAGTCATAGGAAACCTGGG -3'

Sequencing Primer
(F):5'- TAAGCAGGCAGACTGTTTCC -3'
(R):5'- AACCTGGGCATGGTCATG -3'
Posted On 2014-08-25