Mutagenetix > Incidental Mutation

Incidental Mutation 'R1976:Itga10'

221687

Institutional Source

Beutler Lab

Gene Symbol

Itga10

Ensembl Gene

ENSMUSG00000090210

Gene Name

integrin, alpha 10

Synonyms

MMRRC Submission

039989-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.195) question?

Stock #

R1976 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

96645584-96664519 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 96651738 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000121011 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000119365] [ENSMUST00000137564]

AlphaFold

E9Q6R1

Predicted Effect

probably benign
Transcript: ENSMUST00000029744

SMART Domains

Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1123	1145	N/A	INTRINSIC
low complexity region	1153	1166	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119365

SMART Domains

Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1122	1144	N/A	INTRINSIC
low complexity region	1152	1165	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000137564

SMART Domains

Protein: ENSMUSP00000121011
Gene: ENSMUSG00000106447

Domain	Start	End	E-Value	Type
Pfam:PEX11	1	172	4.5e-57	PFAM
low complexity region	186	204	N/A	INTRINSIC
Int_alpha	222	278	9.03e-3	SMART
Blast:VWA	292	345	3e-7	BLAST

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.8%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	C	7: 34,257,380	N353K	probably damaging	Het
Abca13	T	C	11: 9,397,815	V3556A	probably damaging	Het
Abcb5	T	C	12: 118,890,682	I833V	probably benign	Het
Adgrd1	A	T	5: 129,140,797	H432L	probably benign	Het
Alppl2	T	A	1: 87,088,741	I204F	probably damaging	Het
Ascc3	T	A	10: 50,649,166	F486I	probably damaging	Het
Bcl9l	T	A	9: 44,506,152	L429Q	possibly damaging	Het
Ccdc33	A	T	9: 58,117,162	Y227*	probably null	Het
Cd101	A	G	3: 101,008,061	V730A	probably damaging	Het
Cdadc1	A	T	14: 59,573,768	V431E	probably damaging	Het
Dazap1	T	A	10: 80,274,620		probably null	Het
Dbpht2	T	A	12: 74,295,861		noncoding transcript	Het
Dennd4b	A	T	3: 90,273,055	T742S	probably damaging	Het
Dhtkd1	T	C	2: 5,902,391	E838G	possibly damaging	Het
Dync2h1	A	T	9: 7,129,045	D1823E	probably benign	Het
Enox1	T	A	14: 77,668,793	N556K	probably benign	Het
Fam227a	T	C	15: 79,626,276	I392M	possibly damaging	Het
Fnip2	A	T	3: 79,480,931	M831K	probably benign	Het
Foxn1	T	C	11: 78,365,937		probably benign	Het
Glis3	T	C	19: 28,262,677	936	probably benign	Het
Gm4953	T	A	1: 159,168,353		noncoding transcript	Het
Gsr	T	G	8: 33,680,260		probably null	Het
Habp4	G	T	13: 64,184,606	V344F	probably benign	Het
Hdac7	G	A	15: 97,806,505	Q495*	probably null	Het
Helb	T	C	10: 120,094,263	D737G	possibly damaging	Het
Hltf	A	G	3: 20,106,446	D759G	probably damaging	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Itsn2	A	G	12: 4,672,733		probably benign	Het
Kank2	A	T	9: 21,794,561	V387E	probably damaging	Het
Lefty1	T	C	1: 180,937,824	V319A	probably benign	Het
Lonp1	T	C	17: 56,615,068	T771A	possibly damaging	Het
Lpcat2b	A	T	5: 107,433,850	K348N	possibly damaging	Het
Lsamp	T	C	16: 41,889,067	V103A	probably damaging	Het
Ltbp4	A	T	7: 27,326,770	C538S	probably damaging	Het
Micu1	T	C	10: 59,768,213	S174P	probably damaging	Het
Mta1	A	G	12: 113,136,306	N607S	probably damaging	Het
Muc5b	C	T	7: 141,863,154	S3279L	probably benign	Het
Naalad2	T	C	9: 18,378,699	E211G	probably damaging	Het
Nup155	T	A	15: 8,135,827	M649K	probably benign	Het
Pan2	T	C	10: 128,320,413	V1171A	probably damaging	Het
Pisd	A	G	5: 32,738,865	V372A	probably damaging	Het
Prim1	T	A	10: 128,023,799	C288S	probably benign	Het
Rab23	T	A	1: 33,723,938	C30S	probably damaging	Het
Sacs	A	G	14: 61,202,895	T797A	probably benign	Het
Sall3	T	C	18: 80,971,893	D940G	probably benign	Het
Scn1a	T	C	2: 66,331,271	E311G	probably benign	Het
Sdk1	T	A	5: 142,143,818	I1598N	probably damaging	Het
Slc22a17	A	T	14: 54,908,500		probably null	Het
Slc36a4	T	A	9: 15,734,210	V311D	probably damaging	Het
Sprr3	T	A	3: 92,456,946	Q197L	possibly damaging	Het
Stab2	A	C	10: 86,896,496		probably null	Het
Stk4	C	T	2: 164,100,528	T360M	probably benign	Het
Tas2r123	T	A	6: 132,847,332	V64D	probably damaging	Het
Trhde	T	G	10: 114,588,431	N483T	possibly damaging	Het
Trp53	C	T	11: 69,588,497	T167M	probably damaging	Het
Tspan8	A	G	10: 115,844,130	I217V	probably benign	Het
Usp17la	A	G	7: 104,860,320	E44G	possibly damaging	Het
Usp40	T	G	1: 87,978,536	Q659P	probably benign	Het
Vmn1r4	T	C	6: 56,956,738	C76R	probably damaging	Het
Vmn2r118	C	T	17: 55,592,925	G660R	probably damaging	Het
Zcchc11	T	C	4: 108,479,523	L148P	probably benign	Het
Zfp786	T	A	6: 47,819,757	H749L	probably damaging	Het

Other mutations in Itga10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01473:Itga10	APN	3	96647641	missense	probably damaging	0.96
IGL01694:Itga10	APN	3	96652517	missense	probably damaging	0.99
IGL01754:Itga10	APN	3	96656775	unclassified	probably benign
IGL02527:Itga10	APN	3	96655624	unclassified	probably benign
IGL02956:Itga10	APN	3	96655113	missense	possibly damaging	0.46
IGL03371:Itga10	APN	3	96654788	missense	possibly damaging	0.84
IGL03055:Itga10	UTSW	3	96650520	missense	probably damaging	0.99
PIT4515001:Itga10	UTSW	3	96662632	missense	probably damaging	0.99
R0153:Itga10	UTSW	3	96653700	missense	probably benign	0.00
R0308:Itga10	UTSW	3	96651464	missense	probably damaging	1.00
R0331:Itga10	UTSW	3	96652483	missense	probably damaging	1.00
R0413:Itga10	UTSW	3	96649059	missense	probably damaging	1.00
R0437:Itga10	UTSW	3	96649137	missense	probably damaging	1.00
R0511:Itga10	UTSW	3	96658174	missense	probably damaging	1.00
R0630:Itga10	UTSW	3	96656299	unclassified	probably benign
R0844:Itga10	UTSW	3	96651738	splice site	probably benign
R0849:Itga10	UTSW	3	96652530	missense	possibly damaging	0.67
R0894:Itga10	UTSW	3	96653660	missense	possibly damaging	0.69
R0919:Itga10	UTSW	3	96651738	splice site	probably benign
R1027:Itga10	UTSW	3	96651738	splice site	probably benign
R1341:Itga10	UTSW	3	96652495	missense	probably damaging	1.00
R1350:Itga10	UTSW	3	96657477	missense	probably benign	0.01
R1370:Itga10	UTSW	3	96651738	splice site	probably benign
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1589:Itga10	UTSW	3	96651738	splice site	probably benign
R1590:Itga10	UTSW	3	96651738	splice site	probably benign
R1601:Itga10	UTSW	3	96653658	missense	possibly damaging	0.82
R1659:Itga10	UTSW	3	96662977	missense	probably damaging	0.96
R1665:Itga10	UTSW	3	96651738	splice site	probably benign
R1667:Itga10	UTSW	3	96651738	splice site	probably benign
R1686:Itga10	UTSW	3	96651825	missense	probably damaging	0.97
R1972:Itga10	UTSW	3	96651738	splice site	probably benign
R2020:Itga10	UTSW	3	96652490	missense	probably damaging	1.00
R2040:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96657690	missense	probably benign
R2045:Itga10	UTSW	3	96651738	splice site	probably benign
R2060:Itga10	UTSW	3	96654998	nonsense	probably null
R2146:Itga10	UTSW	3	96651492	missense	possibly damaging	0.59
R2146:Itga10	UTSW	3	96653723	missense	probably damaging	1.00
R2170:Itga10	UTSW	3	96650457	missense	probably damaging	1.00
R2893:Itga10	UTSW	3	96655100	missense	probably benign	0.11
R2926:Itga10	UTSW	3	96652849	missense	probably damaging	1.00
R3622:Itga10	UTSW	3	96651738	splice site	probably benign
R3623:Itga10	UTSW	3	96651738	splice site	probably benign
R4416:Itga10	UTSW	3	96658246	missense	possibly damaging	0.58
R4633:Itga10	UTSW	3	96647704	missense	possibly damaging	0.92
R5074:Itga10	UTSW	3	96652211	nonsense	probably null
R5095:Itga10	UTSW	3	96648164	missense	probably benign	0.21
R5495:Itga10	UTSW	3	96647371	missense	possibly damaging	0.92
R5813:Itga10	UTSW	3	96652585	missense	probably benign	0.38
R6114:Itga10	UTSW	3	96649035	missense	probably damaging	1.00
R6172:Itga10	UTSW	3	96647437	missense	probably benign	0.18
R6275:Itga10	UTSW	3	96658185	missense	probably benign	0.36
R6298:Itga10	UTSW	3	96656762	missense	probably benign	0.00
R6433:Itga10	UTSW	3	96658041	critical splice donor site	probably null
R6841:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R6909:Itga10	UTSW	3	96662599	missense	probably benign	0.00
R6927:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R7124:Itga10	UTSW	3	96651765	missense	probably damaging	0.96
R7310:Itga10	UTSW	3	96648159	missense	probably damaging	1.00
R7387:Itga10	UTSW	3	96652778	missense	probably benign	0.11
R7464:Itga10	UTSW	3	96648155	missense	probably damaging	1.00
R7624:Itga10	UTSW	3	96652953	missense	probably benign
R7638:Itga10	UTSW	3	96657391	splice site	probably null
R7639:Itga10	UTSW	3	96649582	missense	probably benign	0.36
R7893:Itga10	UTSW	3	96649612	missense	probably damaging	1.00
R8297:Itga10	UTSW	3	96654800	missense	probably damaging	1.00
R8753:Itga10	UTSW	3	96651155	missense	probably damaging	1.00
R9526:Itga10	UTSW	3	96656957	missense	probably damaging	1.00
X0064:Itga10	UTSW	3	96652936	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TTGGATAGACCCTGACCCTC -3'
(R):5'- ACTCTCTGTGACTCACCCAG -3'

Sequencing Primer
(F):5'- ATAAGCCCCCTACTTCTAATTCAG -3'
(R):5'- TCTCTGTGACTCACCCAGGTAGG -3'

Posted On

2014-08-25