Mutagenetix > Incidental Mutations

Incidental Mutation 'R2044:Rfx6'

221688

Institutional Source

Beutler Lab

Gene Symbol

Rfx6

Ensembl Gene

ENSMUSG00000019900

Gene Name

regulatory factor X, 6

Synonyms

Rfxdc1, 4930572O07Rik

MMRRC Submission

040051-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2044 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

51677756-51730432 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 51718126 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 381 (V381I)

Ref Sequence

ENSEMBL: ENSMUSP00000151430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050455] [ENSMUST00000122922] [ENSMUST00000219364]

Predicted Effect

probably benign
Transcript: ENSMUST00000050455
AA Change: V151I

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000057384
Gene: ENSMUSG00000019900
AA Change: V151I

Domain	Start	End	E-Value	Type
Blast:HisKA	91	153	1e-7	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000122922
AA Change: V415I

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000116057
Gene: ENSMUSG00000019900
AA Change: V415I

Domain	Start	End	E-Value	Type
Pfam:RFX_DNA_binding	120	198	1.9e-33	PFAM
Blast:HisKA	355	417	2e-7	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125729

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217662

Predicted Effect

probably benign
Transcript: ENSMUST00000219364
AA Change: V381I

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

unknown
Transcript: ENSMUST00000219771
AA Change: V202I

Meta Mutation Damage Score

0.0713

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.7%

Validation Efficiency

98% (92/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear protein encoded by this gene is a member of the regulatory factor X (RFX) family of transcription factors. Studies in mice suggest that this gene is specifically required for the differentiation of islet cells for the production of insulin, but not for the differentiation of pancreatic polypeptide-producing cells. It regulates the transcription factors involved in beta-cell maturation and function, thus, restricting the expression of the beta-cell differentiation and specification genes. Mutations in this gene are associated with Mitchell-Riley syndrome, which is characterized by neonatal diabetes with pancreatic hypoplasia, duodenal and jejunal atresia, and gall bladder agenesis.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes fail to feed normally, show small bowel obstruction and die within 2 days of birth. Mutants fail to generate any of the normal islet cell types except for pancreatic-polypeptide-producing cells. Some display a reduced pancreas size; however, primary cilia formation in islets is normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410137M14Rik	G	A	17: 36,978,094		probably benign	Het
Abhd15	A	G	11: 77,518,338	T293A	probably benign	Het
Aldh1l1	C	T	6: 90,562,665	P192L	probably benign	Het
Aldoart1	T	G	4: 72,852,542	I10L	probably benign	Het
Ankhd1	G	A	18: 36,645,113	G1653D	probably benign	Het
Ankk1	A	C	9: 49,419,364		probably null	Het
Astn1	A	G	1: 158,600,502	T748A	possibly damaging	Het
Bmp7	C	A	2: 172,939,915	R52L	possibly damaging	Het
Ccdc151	T	G	9: 21,991,858	T419P	possibly damaging	Het
Ccdc33	G	A	9: 58,031,112	P859S	possibly damaging	Het
Ccny	A	G	18: 9,449,644	S10P	probably damaging	Het
Cdc6	C	A	11: 98,910,461	F179L	probably benign	Het
Cdc7	T	A	5: 106,983,132	V491E	probably benign	Het
Cdh23	G	T	10: 60,596,730	S138R	possibly damaging	Het
Cenpc1	T	C	5: 86,037,755	H299R	probably benign	Het
Ciart	A	T	3: 95,878,701	M354K	probably benign	Het
Clasrp	G	T	7: 19,586,715		probably benign	Het
Col4a3	G	A	1: 82,696,319	G1132E	unknown	Het
Crebbp	G	A	16: 4,084,823	T2184I	probably benign	Het
Cyp2r1	A	C	7: 114,550,405	M458R	probably damaging	Het
Cyp7a1	C	A	4: 6,275,492	R27M	probably null	Het
Ddhd2	A	G	8: 25,752,165	F116L	probably damaging	Het
Dgkd	G	A	1: 87,927,691	R685K	probably benign	Het
Dnah2	A	G	11: 69,524,240	S223P	probably benign	Het
Exph5	A	T	9: 53,372,679	R353S	possibly damaging	Het
F11	C	A	8: 45,252,118	V129F	probably benign	Het
F830045P16Rik	A	T	2: 129,459,397	S454T	possibly damaging	Het
Fam124a	T	C	14: 62,587,207	I50T	probably damaging	Het
Fam20c	T	C	5: 138,756,227		probably null	Het
Fam234b	A	G	6: 135,226,914	T405A	probably benign	Het
Fbxo18	C	A	2: 11,762,970	V356L	possibly damaging	Het
Flywch1	G	A	17: 23,762,313	Q132*	probably null	Het
Foxo6	T	C	4: 120,286,969	D95G	probably benign	Het
Ggt5	T	C	10: 75,604,087	F174S	probably damaging	Het
Gm7104	G	A	12: 88,285,781		noncoding transcript	Het
Gpr155	A	G	2: 73,373,633	L279P	probably damaging	Het
H2-T23	A	G	17: 36,032,191	L98P	probably damaging	Het
Heatr5a	A	G	12: 51,955,403	V250A	probably benign	Het
Heyl	A	T	4: 123,241,363	I50F	probably damaging	Het
Hist4h4	G	C	6: 136,804,103	R93G	possibly damaging	Het
Ifitm10	A	T	7: 142,356,034	S179R	probably damaging	Het
Isg15	A	T	4: 156,199,792	I93N	probably benign	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Itga10	G	A	3: 96,657,690	V985I	probably benign	Het
Kcnt2	T	C	1: 140,375,154	I144T	probably benign	Het
Klk1	A	C	7: 44,229,034	K104T	possibly damaging	Het
Lemd3	C	A	10: 120,933,442	R654L	probably damaging	Het
Lmod1	A	T	1: 135,364,387	M327L	probably benign	Het
Lonrf2	T	C	1: 38,807,050	E347G	probably benign	Het
Ltbp1	A	G	17: 75,276,432	Y409C	probably damaging	Het
Mecom	A	T	3: 29,980,592	Y312N	probably damaging	Het
Mrgprb3	C	T	7: 48,643,734	C23Y	possibly damaging	Het
Mut	A	G	17: 40,941,451	T295A	probably benign	Het
Nadk	C	A	4: 155,585,441	L194I	probably damaging	Het
Naxd	A	G	8: 11,509,510	I182V	probably benign	Het
Nbeal1	T	A	1: 60,319,687	I1176K	probably damaging	Het
Nol4l	C	A	2: 153,529,521	R81L	possibly damaging	Het
Olfr1297	T	A	2: 111,621,814	R87W	probably benign	Het
Olfr1411	G	T	1: 92,596,969	R150L	probably benign	Het
Olfr957	A	T	9: 39,511,378	M114K	probably damaging	Het
Pcdh18	A	G	3: 49,754,940	V642A	probably benign	Het
Pdzk1	G	A	3: 96,855,848		probably benign	Het
Per3	C	T	4: 151,033,938	V233I	probably benign	Het
Pisd	G	A	5: 32,764,796	P267S	possibly damaging	Het
Prm1	T	A	16: 10,796,493		probably benign	Het
Ptprj	A	G	2: 90,463,095	V548A	probably damaging	Het
Ranbp3	G	A	17: 56,673,367		probably benign	Het
Raver2	T	A	4: 101,102,812	V163D	probably damaging	Het
Rbm14	A	T	19: 4,803,877	I159N	possibly damaging	Het
Rhobtb1	T	C	10: 69,272,863		probably benign	Het
Rpl28-ps4	T	A	6: 117,213,895		noncoding transcript	Het
Rsph10b	A	G	5: 143,967,250		probably null	Het
Rspo4	A	G	2: 151,873,093	K217E	unknown	Het
Scgb2b27	G	A	7: 34,013,285	A44V	possibly damaging	Het
Sec14l2	G	A	11: 4,111,435		probably benign	Het
Sec31b	T	C	19: 44,536,156	N101D	probably benign	Het
Sema6a	A	T	18: 47,306,429	C9*	probably null	Het
Sept5	A	C	16: 18,623,012	L331R	probably benign	Het
Slc16a11	C	A	11: 70,215,651	Y238*	probably null	Het
Slc25a12	T	C	2: 71,312,548	T210A	probably benign	Het
Slc35f1	A	T	10: 53,089,347	Y286F	probably damaging	Het
Szt2	A	T	4: 118,376,448	L2225*	probably null	Het
Thap12	T	C	7: 98,716,620	L665P	probably damaging	Het
Tpsb2	T	A	17: 25,367,724	W237R	probably damaging	Het
Tyk2	T	C	9: 21,120,341	D451G	probably damaging	Het
Ube2j1	T	A	4: 33,049,696	N231K	probably benign	Het
Vmn1r225	A	T	17: 20,502,590	T98S	possibly damaging	Het
Vmn1r87	A	T	7: 13,131,821	S180T	probably benign	Het
Vmn2r6	A	G	3: 64,537,841	V821A	probably damaging	Het
Zfp689	C	A	7: 127,444,826	G211C	probably damaging	Het
Zfp827	A	G	8: 79,076,236	D479G	probably benign	Het
Zfp995	A	C	17: 21,880,594	F220V	probably damaging	Het

Other mutations in Rfx6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Rfx6	APN	10	51681886	missense	probably damaging	1.00
IGL00816:Rfx6	APN	10	51678405	missense	probably benign	0.16
IGL01639:Rfx6	APN	10	51715906	nonsense	probably null
IGL01721:Rfx6	APN	10	51723077	missense	probably damaging	1.00
IGL01861:Rfx6	APN	10	51721579	missense	probably damaging	1.00
IGL02103:Rfx6	APN	10	51726856	missense	possibly damaging	0.93
IGL02113:Rfx6	APN	10	51678012	missense	probably benign
IGL02479:Rfx6	APN	10	51678328	missense	probably benign	0.07
IGL02592:Rfx6	APN	10	51716023	missense	probably damaging	1.00
IGL02635:Rfx6	APN	10	51716026	missense	possibly damaging	0.80
IGL02891:Rfx6	APN	10	51723846	missense	possibly damaging	0.64
IGL03153:Rfx6	APN	10	51723121	nonsense	probably null
IGL03263:Rfx6	APN	10	51725807	missense	probably benign	0.00
IGL03373:Rfx6	APN	10	51720000	missense	probably damaging	0.99
bulky	UTSW	10	51678333	missense	probably benign	0.00
R0060:Rfx6	UTSW	10	51677840	missense	probably benign	0.00
R0433:Rfx6	UTSW	10	51720028	missense	probably damaging	1.00
R1329:Rfx6	UTSW	10	51693737	missense	probably damaging	1.00
R1709:Rfx6	UTSW	10	51678402	missense	possibly damaging	0.64
R1820:Rfx6	UTSW	10	51723125	critical splice donor site	probably null
R2017:Rfx6	UTSW	10	51721604	missense	possibly damaging	0.50
R2020:Rfx6	UTSW	10	51720057	critical splice donor site	probably null
R2495:Rfx6	UTSW	10	51726675	splice site	probably benign
R2655:Rfx6	UTSW	10	51693777	splice site	probably benign
R2912:Rfx6	UTSW	10	51718130	missense	probably damaging	1.00
R3159:Rfx6	UTSW	10	51726720	missense	probably damaging	1.00
R4036:Rfx6	UTSW	10	51726746	missense	probably damaging	1.00
R4536:Rfx6	UTSW	10	51723784	missense	probably benign	0.16
R4791:Rfx6	UTSW	10	51719944	splice site	probably null
R4945:Rfx6	UTSW	10	51726851	nonsense	probably null
R5223:Rfx6	UTSW	10	51677996	nonsense	probably null
R5233:Rfx6	UTSW	10	51712091	nonsense	probably null
R5448:Rfx6	UTSW	10	51683637	missense	probably damaging	1.00
R5600:Rfx6	UTSW	10	51723061	missense	probably damaging	1.00
R5768:Rfx6	UTSW	10	51726880	missense	probably damaging	0.99
R5858:Rfx6	UTSW	10	51725868	missense	probably benign	0.00
R5949:Rfx6	UTSW	10	51678333	missense	probably benign	0.00
R6001:Rfx6	UTSW	10	51718211	splice site	probably null
R6003:Rfx6	UTSW	10	51708587	missense	probably damaging	1.00
R6118:Rfx6	UTSW	10	51711866	missense	possibly damaging	0.91
R6629:Rfx6	UTSW	10	51725490	missense	probably benign	0.02
R6876:Rfx6	UTSW	10	51719991	missense	probably damaging	1.00
R6894:Rfx6	UTSW	10	51716039	missense	probably damaging	1.00
R6912:Rfx6	UTSW	10	51723853	missense	probably benign	0.00
R7130:Rfx6	UTSW	10	51678380	nonsense	probably null
R7574:Rfx6	UTSW	10	51681818	missense	probably benign	0.17
V8831:Rfx6	UTSW	10	51718208	critical splice donor site	probably null
X0023:Rfx6	UTSW	10	51678411	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTATTTACACTCAGACACACTCAAGAG -3'
(R):5'- GCTGTGATTTTGCTATCAGAGAC -3'

Sequencing Primer
(F):5'- TCAGACACACTCAAGAGAGAAG -3'
(R):5'- ACCCTGTGAAAGGCTCATTG -3'

Posted On

2014-08-25