Incidental Mutation 'R2044:Cdh23'
ID221691
Institutional Source Beutler Lab
Gene Symbol Cdh23
Ensembl Gene ENSMUSG00000012819
Gene Namecadherin 23 (otocadherin)
Synonymsnmf252, bob, ahl, mdfw, 4930542A03Rik, sals, nmf112, nmf181, USH1D
MMRRC Submission 040051-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.653) question?
Stock #R2044 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location60302748-60696490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 60596730 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 138 (S138R)
Ref Sequence ENSEMBL: ENSMUSP00000101103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073242] [ENSMUST00000105461] [ENSMUST00000105462] [ENSMUST00000105463] [ENSMUST00000105464]
PDB Structure
Crystal structure of mouse cadherin-23 EC1 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE CADHERIN-23 EC1-2 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF NONSYNDROMIC DEAFNESS (DFNB12) ASSOCIATED MUTANT D124G OF MOUSE CADHERIN-23 EC1-2 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE CADHERIN-23 EC1-2 (ALL CATION BINDING SITES OCCUPIED BY CALCIUM) [X-RAY DIFFRACTION]
Structure of the N-terminus of Cadherin 23 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE CADHERIN-23 EC1-2 AND PROTOCADHERIN-15 EC1- 2 FORM I [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE CADHERIN-23 EC1-2 AND PROTOCADHERIN-15 EC1- 2 FORM II [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF DEAFNESS ASSOCIATED MUTANT MOUSE CADHERIN-23 EC1- 2D124G AND PROTOCADHERIN-15 EC1-2 FORM I [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF DEAFNESS ASSOCIATED MUTANT MOUSE CADHERIN-23 EC1- 2S70P AND PROTOCADHERIN-15 EC1-2 FORM I [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE CADHERIN-23 EC1-2 AND PROTOCADHERIN-15 EC1- 2, FORM I 2.2A. [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073242
AA Change: S138R

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000072973
Gene: ENSMUSG00000012819
AA Change: S138R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 8.11e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1415 1.21e-18 SMART
CA 1440 1524 2.38e-26 SMART
CA 1549 1631 6.27e-26 SMART
CA 1656 1741 6.99e-24 SMART
CA 1765 1848 3.49e-24 SMART
CA 1872 1956 2.78e-18 SMART
CA 1984 2066 5.6e-14 SMART
CA 2090 2171 2.59e-27 SMART
CA 2195 2290 2.87e-11 SMART
CA 2317 2399 1.01e-20 SMART
CA 2423 2506 1.09e-25 SMART
CA 2530 2608 7.91e-23 SMART
CA 2634 2719 1.06e-23 SMART
CA 2750 2843 2e-10 SMART
Blast:CA 2867 2956 4e-51 BLAST
transmembrane domain 3067 3089 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105461
AA Change: S138R

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101101
Gene: ENSMUSG00000012819
AA Change: S138R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105462
AA Change: S138R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101102
Gene: ENSMUSG00000012819
AA Change: S138R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 261 349 2.03e-11 SMART
CA 374 461 8.11e-11 SMART
CA 485 562 1.04e-22 SMART
CA 586 672 3.55e-25 SMART
CA 696 779 2.04e-25 SMART
CA 803 891 5.03e-16 SMART
CA 915 996 1.05e-27 SMART
CA 1020 1103 1.99e-19 SMART
CA 1127 1209 6.94e-19 SMART
CA 1234 1314 1.99e-19 SMART
CA 1338 1418 1.21e-18 SMART
CA 1443 1527 2.38e-26 SMART
CA 1552 1634 6.27e-26 SMART
CA 1659 1744 6.99e-24 SMART
CA 1768 1851 3.49e-24 SMART
CA 1875 1959 2.78e-18 SMART
CA 1987 2069 5.6e-14 SMART
CA 2093 2174 2.59e-27 SMART
CA 2198 2293 2.87e-11 SMART
CA 2320 2402 1.01e-20 SMART
CA 2426 2509 1.09e-25 SMART
CA 2533 2611 7.91e-23 SMART
CA 2637 2722 1.06e-23 SMART
CA 2753 2846 2e-10 SMART
Blast:CA 2870 2959 4e-51 BLAST
transmembrane domain 3070 3092 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105463
AA Change: S138R

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101103
Gene: ENSMUSG00000012819
AA Change: S138R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105464
AA Change: S138R

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101104
Gene: ENSMUSG00000012819
AA Change: S138R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 456 3.58e-12 SMART
CA 480 557 1.04e-22 SMART
CA 581 667 3.55e-25 SMART
CA 691 774 2.04e-25 SMART
CA 798 886 5.03e-16 SMART
CA 910 991 1.05e-27 SMART
CA 1015 1098 1.99e-19 SMART
CA 1122 1204 6.94e-19 SMART
CA 1229 1309 1.99e-19 SMART
CA 1333 1414 5.26e-19 SMART
CA 1439 1523 2.38e-26 SMART
CA 1548 1630 6.27e-26 SMART
CA 1655 1740 6.99e-24 SMART
CA 1764 1847 3.49e-24 SMART
CA 1871 1955 2.78e-18 SMART
CA 1983 2065 5.6e-14 SMART
CA 2089 2170 2.59e-27 SMART
CA 2194 2289 2.87e-11 SMART
CA 2316 2398 1.01e-20 SMART
CA 2422 2505 1.09e-25 SMART
CA 2529 2607 7.91e-23 SMART
CA 2633 2718 1.06e-23 SMART
CA 2749 2842 2e-10 SMART
Blast:CA 2866 2955 3e-51 BLAST
transmembrane domain 3066 3088 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153149
Meta Mutation Damage Score 0.1286 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]
PHENOTYPE: Mutant mice exhibit circling behavior, tilting of the head and are deaf. Mice homozygous for a targeted knock-out exhibit abnormal outer hair cells morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 36,978,094 probably benign Het
Abhd15 A G 11: 77,518,338 T293A probably benign Het
Aldh1l1 C T 6: 90,562,665 P192L probably benign Het
Aldoart1 T G 4: 72,852,542 I10L probably benign Het
Ankhd1 G A 18: 36,645,113 G1653D probably benign Het
Ankk1 A C 9: 49,419,364 probably null Het
Astn1 A G 1: 158,600,502 T748A possibly damaging Het
Bmp7 C A 2: 172,939,915 R52L possibly damaging Het
Ccdc151 T G 9: 21,991,858 T419P possibly damaging Het
Ccdc33 G A 9: 58,031,112 P859S possibly damaging Het
Ccny A G 18: 9,449,644 S10P probably damaging Het
Cdc6 C A 11: 98,910,461 F179L probably benign Het
Cdc7 T A 5: 106,983,132 V491E probably benign Het
Cenpc1 T C 5: 86,037,755 H299R probably benign Het
Ciart A T 3: 95,878,701 M354K probably benign Het
Clasrp G T 7: 19,586,715 probably benign Het
Col4a3 G A 1: 82,696,319 G1132E unknown Het
Crebbp G A 16: 4,084,823 T2184I probably benign Het
Cyp2r1 A C 7: 114,550,405 M458R probably damaging Het
Cyp7a1 C A 4: 6,275,492 R27M probably null Het
Ddhd2 A G 8: 25,752,165 F116L probably damaging Het
Dgkd G A 1: 87,927,691 R685K probably benign Het
Dnah2 A G 11: 69,524,240 S223P probably benign Het
Exph5 A T 9: 53,372,679 R353S possibly damaging Het
F11 C A 8: 45,252,118 V129F probably benign Het
F830045P16Rik A T 2: 129,459,397 S454T possibly damaging Het
Fam124a T C 14: 62,587,207 I50T probably damaging Het
Fam20c T C 5: 138,756,227 probably null Het
Fam234b A G 6: 135,226,914 T405A probably benign Het
Fbxo18 C A 2: 11,762,970 V356L possibly damaging Het
Flywch1 G A 17: 23,762,313 Q132* probably null Het
Foxo6 T C 4: 120,286,969 D95G probably benign Het
Ggt5 T C 10: 75,604,087 F174S probably damaging Het
Gm7104 G A 12: 88,285,781 noncoding transcript Het
Gpr155 A G 2: 73,373,633 L279P probably damaging Het
H2-T23 A G 17: 36,032,191 L98P probably damaging Het
Heatr5a A G 12: 51,955,403 V250A probably benign Het
Heyl A T 4: 123,241,363 I50F probably damaging Het
Hist4h4 G C 6: 136,804,103 R93G possibly damaging Het
Ifitm10 A T 7: 142,356,034 S179R probably damaging Het
Isg15 A T 4: 156,199,792 I93N probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itga10 G A 3: 96,657,690 V985I probably benign Het
Kcnt2 T C 1: 140,375,154 I144T probably benign Het
Klk1 A C 7: 44,229,034 K104T possibly damaging Het
Lemd3 C A 10: 120,933,442 R654L probably damaging Het
Lmod1 A T 1: 135,364,387 M327L probably benign Het
Lonrf2 T C 1: 38,807,050 E347G probably benign Het
Ltbp1 A G 17: 75,276,432 Y409C probably damaging Het
Mecom A T 3: 29,980,592 Y312N probably damaging Het
Mrgprb3 C T 7: 48,643,734 C23Y possibly damaging Het
Mut A G 17: 40,941,451 T295A probably benign Het
Nadk C A 4: 155,585,441 L194I probably damaging Het
Naxd A G 8: 11,509,510 I182V probably benign Het
Nbeal1 T A 1: 60,319,687 I1176K probably damaging Het
Nol4l C A 2: 153,529,521 R81L possibly damaging Het
Olfr1297 T A 2: 111,621,814 R87W probably benign Het
Olfr1411 G T 1: 92,596,969 R150L probably benign Het
Olfr957 A T 9: 39,511,378 M114K probably damaging Het
Pcdh18 A G 3: 49,754,940 V642A probably benign Het
Pdzk1 G A 3: 96,855,848 probably benign Het
Per3 C T 4: 151,033,938 V233I probably benign Het
Pisd G A 5: 32,764,796 P267S possibly damaging Het
Prm1 T A 16: 10,796,493 probably benign Het
Ptprj A G 2: 90,463,095 V548A probably damaging Het
Ranbp3 G A 17: 56,673,367 probably benign Het
Raver2 T A 4: 101,102,812 V163D probably damaging Het
Rbm14 A T 19: 4,803,877 I159N possibly damaging Het
Rfx6 G A 10: 51,718,126 V381I probably benign Het
Rhobtb1 T C 10: 69,272,863 probably benign Het
Rpl28-ps4 T A 6: 117,213,895 noncoding transcript Het
Rsph10b A G 5: 143,967,250 probably null Het
Rspo4 A G 2: 151,873,093 K217E unknown Het
Scgb2b27 G A 7: 34,013,285 A44V possibly damaging Het
Sec14l2 G A 11: 4,111,435 probably benign Het
Sec31b T C 19: 44,536,156 N101D probably benign Het
Sema6a A T 18: 47,306,429 C9* probably null Het
Sept5 A C 16: 18,623,012 L331R probably benign Het
Slc16a11 C A 11: 70,215,651 Y238* probably null Het
Slc25a12 T C 2: 71,312,548 T210A probably benign Het
Slc35f1 A T 10: 53,089,347 Y286F probably damaging Het
Szt2 A T 4: 118,376,448 L2225* probably null Het
Thap12 T C 7: 98,716,620 L665P probably damaging Het
Tpsb2 T A 17: 25,367,724 W237R probably damaging Het
Tyk2 T C 9: 21,120,341 D451G probably damaging Het
Ube2j1 T A 4: 33,049,696 N231K probably benign Het
Vmn1r225 A T 17: 20,502,590 T98S possibly damaging Het
Vmn1r87 A T 7: 13,131,821 S180T probably benign Het
Vmn2r6 A G 3: 64,537,841 V821A probably damaging Het
Zfp689 C A 7: 127,444,826 G211C probably damaging Het
Zfp827 A G 8: 79,076,236 D479G probably benign Het
Zfp995 A C 17: 21,880,594 F220V probably damaging Het
Other mutations in Cdh23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Cdh23 APN 10 60523548 missense probably benign 0.03
IGL00429:Cdh23 APN 10 60421141 missense probably damaging 0.97
IGL01014:Cdh23 APN 10 60307522 missense probably damaging 0.99
IGL01284:Cdh23 APN 10 60466097 missense possibly damaging 0.95
IGL01305:Cdh23 APN 10 60312624 missense probably damaging 1.00
IGL01367:Cdh23 APN 10 60310787 missense probably damaging 1.00
IGL01396:Cdh23 APN 10 60385069 missense possibly damaging 0.93
IGL01412:Cdh23 APN 10 60314694 missense probably damaging 1.00
IGL01461:Cdh23 APN 10 60409147 missense possibly damaging 0.53
IGL01469:Cdh23 APN 10 60597725 missense probably benign 0.03
IGL01695:Cdh23 APN 10 60331833 missense probably benign 0.20
IGL01734:Cdh23 APN 10 60303513 missense probably benign
IGL01767:Cdh23 APN 10 60315724 missense probably damaging 1.00
IGL01796:Cdh23 APN 10 60311137 missense probably benign 0.31
IGL01843:Cdh23 APN 10 60419819 splice site probably null
IGL02025:Cdh23 APN 10 60385143 missense probably damaging 1.00
IGL02071:Cdh23 APN 10 60523560 missense possibly damaging 0.93
IGL02160:Cdh23 APN 10 60597765 splice site probably benign
IGL02175:Cdh23 APN 10 60331308 missense possibly damaging 0.92
IGL02220:Cdh23 APN 10 60305124 missense probably damaging 1.00
IGL02302:Cdh23 APN 10 60323523 missense possibly damaging 0.87
IGL02331:Cdh23 APN 10 60465543 missense probably damaging 0.99
IGL02452:Cdh23 APN 10 60317942 missense probably damaging 0.99
IGL02499:Cdh23 APN 10 60385179 missense probably damaging 1.00
IGL02548:Cdh23 APN 10 60650122 missense probably benign 0.37
IGL02593:Cdh23 APN 10 60465995 splice site probably benign
IGL02626:Cdh23 APN 10 60391801 missense probably damaging 1.00
IGL02951:Cdh23 APN 10 60311364 missense probably damaging 1.00
IGL03145:Cdh23 APN 10 60376814 missense probably damaging 0.99
dee_dee UTSW 10 60308056 nonsense probably null
hersey UTSW 10 60308036 missense probably damaging 1.00
ANU22:Cdh23 UTSW 10 60312624 missense probably damaging 1.00
IGL02980:Cdh23 UTSW 10 60314620 missense probably damaging 1.00
PIT4362001:Cdh23 UTSW 10 60465458 missense probably benign 0.15
R0013:Cdh23 UTSW 10 60413173 missense possibly damaging 0.90
R0045:Cdh23 UTSW 10 60530978 missense probably damaging 1.00
R0045:Cdh23 UTSW 10 60530978 missense probably damaging 1.00
R0082:Cdh23 UTSW 10 60312587 missense probably damaging 1.00
R0124:Cdh23 UTSW 10 60308056 nonsense probably null
R0172:Cdh23 UTSW 10 60319632 missense probably damaging 1.00
R0195:Cdh23 UTSW 10 60317059 missense probably damaging 0.99
R0365:Cdh23 UTSW 10 60379315 missense probably damaging 0.99
R0437:Cdh23 UTSW 10 60410797 missense probably damaging 1.00
R0486:Cdh23 UTSW 10 60386946 missense probably damaging 1.00
R0494:Cdh23 UTSW 10 60316596 splice site probably benign
R0545:Cdh23 UTSW 10 60331291 missense probably benign 0.06
R0619:Cdh23 UTSW 10 60433777 missense probably damaging 1.00
R0647:Cdh23 UTSW 10 60307902 missense probably damaging 0.99
R0647:Cdh23 UTSW 10 60323374 nonsense probably null
R0730:Cdh23 UTSW 10 60323714 missense probably damaging 0.99
R0880:Cdh23 UTSW 10 60406421 missense possibly damaging 0.51
R0942:Cdh23 UTSW 10 60410860 missense possibly damaging 0.67
R0989:Cdh23 UTSW 10 60534510 missense probably damaging 0.99
R1017:Cdh23 UTSW 10 60331793 missense probably damaging 1.00
R1173:Cdh23 UTSW 10 60312392 splice site probably benign
R1449:Cdh23 UTSW 10 60376951 missense probably damaging 1.00
R1456:Cdh23 UTSW 10 60487120 missense possibly damaging 0.84
R1519:Cdh23 UTSW 10 60379343 missense possibly damaging 0.92
R1532:Cdh23 UTSW 10 60314331 missense probably damaging 0.99
R1559:Cdh23 UTSW 10 60419699 splice site probably benign
R1704:Cdh23 UTSW 10 60314611 missense probably damaging 1.00
R1711:Cdh23 UTSW 10 60523536 missense probably benign 0.07
R1760:Cdh23 UTSW 10 60326076 missense probably damaging 1.00
R1782:Cdh23 UTSW 10 60488542 missense probably damaging 1.00
R1791:Cdh23 UTSW 10 60391726 missense possibly damaging 0.89
R1803:Cdh23 UTSW 10 60331281 missense probably damaging 1.00
R1857:Cdh23 UTSW 10 60323297 missense probably damaging 1.00
R1874:Cdh23 UTSW 10 60436818 missense possibly damaging 0.52
R1914:Cdh23 UTSW 10 60323570 missense probably damaging 0.99
R1958:Cdh23 UTSW 10 60410873 missense probably benign 0.02
R1964:Cdh23 UTSW 10 60385222 missense probably benign 0.31
R1966:Cdh23 UTSW 10 60323582 missense probably damaging 1.00
R1981:Cdh23 UTSW 10 60378751 missense probably damaging 1.00
R2010:Cdh23 UTSW 10 60314227 missense probably damaging 0.99
R2036:Cdh23 UTSW 10 60466043 missense possibly damaging 0.52
R2038:Cdh23 UTSW 10 60312587 missense probably damaging 1.00
R2111:Cdh23 UTSW 10 60305583 missense probably damaging 0.99
R2112:Cdh23 UTSW 10 60305583 missense probably damaging 0.99
R2211:Cdh23 UTSW 10 60466004 missense possibly damaging 0.92
R2261:Cdh23 UTSW 10 60317128 missense probably damaging 1.00
R2262:Cdh23 UTSW 10 60317128 missense probably damaging 1.00
R2306:Cdh23 UTSW 10 60323445 missense probably damaging 1.00
R2344:Cdh23 UTSW 10 60316724 missense probably damaging 1.00
R2857:Cdh23 UTSW 10 60382653 critical splice donor site probably null
R2858:Cdh23 UTSW 10 60382653 critical splice donor site probably null
R2859:Cdh23 UTSW 10 60382653 critical splice donor site probably null
R2876:Cdh23 UTSW 10 60307496 missense probably damaging 1.00
R3034:Cdh23 UTSW 10 60409010 splice site probably benign
R3424:Cdh23 UTSW 10 60376881 missense possibly damaging 0.76
R3699:Cdh23 UTSW 10 60327370 critical splice donor site probably null
R3700:Cdh23 UTSW 10 60327370 critical splice donor site probably null
R3950:Cdh23 UTSW 10 60657326 missense probably benign 0.04
R3951:Cdh23 UTSW 10 60657326 missense probably benign 0.04
R3952:Cdh23 UTSW 10 60657326 missense probably benign 0.04
R4108:Cdh23 UTSW 10 60410822 missense possibly damaging 0.51
R4114:Cdh23 UTSW 10 60421040 splice site probably null
R4273:Cdh23 UTSW 10 60311161 missense possibly damaging 0.69
R4284:Cdh23 UTSW 10 60303493 missense possibly damaging 0.91
R4334:Cdh23 UTSW 10 60385059 missense probably damaging 0.99
R4474:Cdh23 UTSW 10 60311086 missense probably damaging 1.00
R4532:Cdh23 UTSW 10 60534423 missense probably benign 0.32
R4597:Cdh23 UTSW 10 60409044 missense probably damaging 1.00
R4604:Cdh23 UTSW 10 60337666 missense possibly damaging 0.93
R4793:Cdh23 UTSW 10 60331350 missense probably damaging 1.00
R4816:Cdh23 UTSW 10 60409077 missense possibly damaging 0.93
R4833:Cdh23 UTSW 10 60385038 missense probably damaging 1.00
R4840:Cdh23 UTSW 10 60419777 missense possibly damaging 0.53
R4857:Cdh23 UTSW 10 60391784 missense probably damaging 1.00
R4869:Cdh23 UTSW 10 60376934 missense probably damaging 1.00
R4894:Cdh23 UTSW 10 60337851 missense probably benign 0.04
R4940:Cdh23 UTSW 10 60307935 missense probably damaging 0.98
R5020:Cdh23 UTSW 10 60308032 missense probably damaging 0.99
R5026:Cdh23 UTSW 10 60304848 missense possibly damaging 0.88
R5081:Cdh23 UTSW 10 60436807 missense possibly damaging 0.89
R5138:Cdh23 UTSW 10 60312282 missense probably damaging 1.00
R5236:Cdh23 UTSW 10 60312572 missense probably damaging 1.00
R5361:Cdh23 UTSW 10 60657265 critical splice donor site probably null
R5384:Cdh23 UTSW 10 60337762 missense probably damaging 0.99
R5500:Cdh23 UTSW 10 60314311 missense probably damaging 1.00
R5512:Cdh23 UTSW 10 60534386 splice site probably null
R5673:Cdh23 UTSW 10 60307857 missense probably damaging 1.00
R5720:Cdh23 UTSW 10 60393023 missense possibly damaging 0.71
R5726:Cdh23 UTSW 10 60407480 missense probably damaging 0.98
R5732:Cdh23 UTSW 10 60331317 missense possibly damaging 0.80
R5739:Cdh23 UTSW 10 60305609 missense probably damaging 0.99
R5760:Cdh23 UTSW 10 60406392 missense probably damaging 0.99
R5793:Cdh23 UTSW 10 60306128 missense probably damaging 1.00
R5880:Cdh23 UTSW 10 60384934 missense probably damaging 1.00
R5905:Cdh23 UTSW 10 60534535 missense probably damaging 0.98
R5907:Cdh23 UTSW 10 60428379 missense probably damaging 1.00
R5910:Cdh23 UTSW 10 60377821 missense possibly damaging 0.81
R5932:Cdh23 UTSW 10 60392984 missense probably damaging 1.00
R5996:Cdh23 UTSW 10 60413577 missense possibly damaging 0.85
R6015:Cdh23 UTSW 10 60307982 missense probably damaging 0.97
R6020:Cdh23 UTSW 10 60331326 missense probably damaging 1.00
R6023:Cdh23 UTSW 10 60465542 missense probably damaging 1.00
R6028:Cdh23 UTSW 10 60534535 missense probably damaging 0.98
R6066:Cdh23 UTSW 10 60433758 missense probably damaging 1.00
R6137:Cdh23 UTSW 10 60434512 missense probably damaging 0.96
R6211:Cdh23 UTSW 10 60410821 missense possibly damaging 0.90
R6298:Cdh23 UTSW 10 60426672 nonsense probably null
R6302:Cdh23 UTSW 10 60305093 missense possibly damaging 0.74
R6338:Cdh23 UTSW 10 60413151 missense probably damaging 1.00
R6356:Cdh23 UTSW 10 60438847 missense probably damaging 1.00
R6441:Cdh23 UTSW 10 60308036 missense probably damaging 1.00
R6714:Cdh23 UTSW 10 60331830 missense possibly damaging 0.62
R6760:Cdh23 UTSW 10 60306168 missense probably damaging 1.00
R6807:Cdh23 UTSW 10 60378871 missense possibly damaging 0.95
R6855:Cdh23 UTSW 10 60306122 missense possibly damaging 0.66
R6937:Cdh23 UTSW 10 60487114 missense probably damaging 1.00
R6942:Cdh23 UTSW 10 60438856 missense possibly damaging 0.93
R6961:Cdh23 UTSW 10 60650114 missense probably benign 0.00
R7009:Cdh23 UTSW 10 60337306 missense probably damaging 0.99
R7010:Cdh23 UTSW 10 60530991 missense probably benign 0.03
R7032:Cdh23 UTSW 10 60331788 missense probably damaging 1.00
R7046:Cdh23 UTSW 10 60378751 missense probably damaging 1.00
R7111:Cdh23 UTSW 10 60387044 missense probably damaging 1.00
R7196:Cdh23 UTSW 10 60307980 missense probably damaging 0.99
R7198:Cdh23 UTSW 10 60312599 missense possibly damaging 0.91
R7223:Cdh23 UTSW 10 60331817 missense probably damaging 1.00
R7290:Cdh23 UTSW 10 60376841 missense probably benign
R7335:Cdh23 UTSW 10 60305116 missense probably damaging 1.00
R7340:Cdh23 UTSW 10 60530996 missense probably benign 0.19
R7350:Cdh23 UTSW 10 60410910 missense probably damaging 1.00
R7366:Cdh23 UTSW 10 60315692 nonsense probably null
R7374:Cdh23 UTSW 10 60317900 missense probably damaging 0.99
R7455:Cdh23 UTSW 10 60306224 missense possibly damaging 0.82
R7537:Cdh23 UTSW 10 60384945 missense probably benign 0.17
R7573:Cdh23 UTSW 10 60323550 missense probably benign 0.17
R7578:Cdh23 UTSW 10 60407407 missense probably benign 0.14
R7646:Cdh23 UTSW 10 60305152 missense possibly damaging 0.95
R7703:Cdh23 UTSW 10 60337264 missense probably damaging 1.00
R7763:Cdh23 UTSW 10 60312577 missense probably damaging 1.00
R7797:Cdh23 UTSW 10 60385194 missense probably benign 0.07
X0052:Cdh23 UTSW 10 60385134 missense probably damaging 1.00
Z1088:Cdh23 UTSW 10 60413644 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- CTCAAGTAGAACCCGAGCTAG -3'
(R):5'- GGAGTTCTCTGTCAGTGACCAC -3'

Sequencing Primer
(F):5'- TCAAGTAGAACCCGAGCTAGAGTATG -3'
(R):5'- AAGCCCTGTTGCTCTGGAAAG -3'
Posted On2014-08-25