Incidental Mutation 'R2044:Sec14l2'
ID 221700
Institutional Source Beutler Lab
Gene Symbol Sec14l2
Ensembl Gene ENSMUSG00000003585
Gene Name SEC14-like lipid binding 2
Synonyms Spf, tap, 1300013M05Rik
MMRRC Submission 040051-MU
Accession Numbers

Ncbi RefSeq: NM_144520.2; MGI:1915065

Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock # R2044 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 4097039-4123415 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 4111435 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000003681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003681]
AlphaFold Q99J08
Predicted Effect probably benign
Transcript: ENSMUST00000003681
SMART Domains Protein: ENSMUSP00000003681
Gene: ENSMUSG00000003585

DomainStartEndE-ValueType
CRAL_TRIO_N 34 59 1.16e-6 SMART
SEC14 76 246 8.31e-62 SMART
Blast:SEC14 257 338 2e-42 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145173
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 98% (92/94)
MGI Phenotype Strain: 3771069
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic protein which belongs to a family of lipid-binding proteins including Sec14p, alpha-tocopherol transfer protein, and cellular retinol-binding protein. The encoded protein stimulates squalene monooxygenase which is a downstream enzyme in the cholesterol biosynthetic pathway. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased cholesterol synthesis and plasma levels under fasting conditions compared to wild-type mice. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(4) Gene trapped(1)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 36,978,094 probably benign Het
Abhd15 A G 11: 77,518,338 T293A probably benign Het
Aldh1l1 C T 6: 90,562,665 P192L probably benign Het
Aldoart1 T G 4: 72,852,542 I10L probably benign Het
Ankhd1 G A 18: 36,645,113 G1653D probably benign Het
Ankk1 A C 9: 49,419,364 probably null Het
Astn1 A G 1: 158,600,502 T748A possibly damaging Het
Bmp7 C A 2: 172,939,915 R52L possibly damaging Het
Ccdc151 T G 9: 21,991,858 T419P possibly damaging Het
Ccdc33 G A 9: 58,031,112 P859S possibly damaging Het
Ccny A G 18: 9,449,644 S10P probably damaging Het
Cdc6 C A 11: 98,910,461 F179L probably benign Het
Cdc7 T A 5: 106,983,132 V491E probably benign Het
Cdh23 G T 10: 60,596,730 S138R possibly damaging Het
Cenpc1 T C 5: 86,037,755 H299R probably benign Het
Ciart A T 3: 95,878,701 M354K probably benign Het
Clasrp G T 7: 19,586,715 probably benign Het
Col4a3 G A 1: 82,696,319 G1132E unknown Het
Crebbp G A 16: 4,084,823 T2184I probably benign Het
Cyp2r1 A C 7: 114,550,405 M458R probably damaging Het
Cyp7a1 C A 4: 6,275,492 R27M probably null Het
Ddhd2 A G 8: 25,752,165 F116L probably damaging Het
Dgkd G A 1: 87,927,691 R685K probably benign Het
Dnah2 A G 11: 69,524,240 S223P probably benign Het
Exph5 A T 9: 53,372,679 R353S possibly damaging Het
F11 C A 8: 45,252,118 V129F probably benign Het
F830045P16Rik A T 2: 129,459,397 S454T possibly damaging Het
Fam124a T C 14: 62,587,207 I50T probably damaging Het
Fam20c T C 5: 138,756,227 probably null Het
Fam234b A G 6: 135,226,914 T405A probably benign Het
Fbxo18 C A 2: 11,762,970 V356L possibly damaging Het
Flywch1 G A 17: 23,762,313 Q132* probably null Het
Foxo6 T C 4: 120,286,969 D95G probably benign Het
Ggt5 T C 10: 75,604,087 F174S probably damaging Het
Gm7104 G A 12: 88,285,781 noncoding transcript Het
Gpr155 A G 2: 73,373,633 L279P probably damaging Het
H2-T23 A G 17: 36,032,191 L98P probably damaging Het
Heatr5a A G 12: 51,955,403 V250A probably benign Het
Heyl A T 4: 123,241,363 I50F probably damaging Het
Hist4h4 G C 6: 136,804,103 R93G possibly damaging Het
Ifitm10 A T 7: 142,356,034 S179R probably damaging Het
Isg15 A T 4: 156,199,792 I93N probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itga10 G A 3: 96,657,690 V985I probably benign Het
Kcnt2 T C 1: 140,375,154 I144T probably benign Het
Klk1 A C 7: 44,229,034 K104T possibly damaging Het
Lemd3 C A 10: 120,933,442 R654L probably damaging Het
Lmod1 A T 1: 135,364,387 M327L probably benign Het
Lonrf2 T C 1: 38,807,050 E347G probably benign Het
Ltbp1 A G 17: 75,276,432 Y409C probably damaging Het
Mecom A T 3: 29,980,592 Y312N probably damaging Het
Mrgprb3 C T 7: 48,643,734 C23Y possibly damaging Het
Mut A G 17: 40,941,451 T295A probably benign Het
Nadk C A 4: 155,585,441 L194I probably damaging Het
Naxd A G 8: 11,509,510 I182V probably benign Het
Nbeal1 T A 1: 60,319,687 I1176K probably damaging Het
Nol4l C A 2: 153,529,521 R81L possibly damaging Het
Olfr1297 T A 2: 111,621,814 R87W probably benign Het
Olfr1411 G T 1: 92,596,969 R150L probably benign Het
Olfr957 A T 9: 39,511,378 M114K probably damaging Het
Pcdh18 A G 3: 49,754,940 V642A probably benign Het
Pdzk1 G A 3: 96,855,848 probably benign Het
Per3 C T 4: 151,033,938 V233I probably benign Het
Pisd G A 5: 32,764,796 P267S possibly damaging Het
Prm1 T A 16: 10,796,493 probably benign Het
Ptprj A G 2: 90,463,095 V548A probably damaging Het
Ranbp3 G A 17: 56,673,367 probably benign Het
Raver2 T A 4: 101,102,812 V163D probably damaging Het
Rbm14 A T 19: 4,803,877 I159N possibly damaging Het
Rfx6 G A 10: 51,718,126 V381I probably benign Het
Rhobtb1 T C 10: 69,272,863 probably benign Het
Rpl28-ps4 T A 6: 117,213,895 noncoding transcript Het
Rsph10b A G 5: 143,967,250 probably null Het
Rspo4 A G 2: 151,873,093 K217E unknown Het
Scgb2b27 G A 7: 34,013,285 A44V possibly damaging Het
Sec31b T C 19: 44,536,156 N101D probably benign Het
Sema6a A T 18: 47,306,429 C9* probably null Het
Sept5 A C 16: 18,623,012 L331R probably benign Het
Slc16a11 C A 11: 70,215,651 Y238* probably null Het
Slc25a12 T C 2: 71,312,548 T210A probably benign Het
Slc35f1 A T 10: 53,089,347 Y286F probably damaging Het
Szt2 A T 4: 118,376,448 L2225* probably null Het
Thap12 T C 7: 98,716,620 L665P probably damaging Het
Tpsb2 T A 17: 25,367,724 W237R probably damaging Het
Tyk2 T C 9: 21,120,341 D451G probably damaging Het
Ube2j1 T A 4: 33,049,696 N231K probably benign Het
Vmn1r225 A T 17: 20,502,590 T98S possibly damaging Het
Vmn1r87 A T 7: 13,131,821 S180T probably benign Het
Vmn2r6 A G 3: 64,537,841 V821A probably damaging Het
Zfp689 C A 7: 127,444,826 G211C probably damaging Het
Zfp827 A G 8: 79,076,236 D479G probably benign Het
Zfp995 A C 17: 21,880,594 F220V probably damaging Het
Other mutations in Sec14l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Sec14l2 APN 11 4098317 missense probably benign
IGL01369:Sec14l2 APN 11 4103432 missense probably benign 0.03
IGL01404:Sec14l2 APN 11 4116710 missense possibly damaging 0.71
IGL01622:Sec14l2 APN 11 4103966 missense possibly damaging 0.58
IGL01623:Sec14l2 APN 11 4103966 missense possibly damaging 0.58
IGL02007:Sec14l2 APN 11 4111114 missense probably benign 0.00
IGL02632:Sec14l2 APN 11 4111222 missense probably benign 0.00
IGL02644:Sec14l2 APN 11 4103380 splice site probably benign
Samoas UTSW 11 4103980 missense possibly damaging 0.74
P0027:Sec14l2 UTSW 11 4103673 critical splice donor site probably null
PIT1430001:Sec14l2 UTSW 11 4109209 nonsense probably null
R0113:Sec14l2 UTSW 11 4103661 splice site probably benign
R1705:Sec14l2 UTSW 11 4103980 missense possibly damaging 0.74
R2180:Sec14l2 UTSW 11 4108964 missense probably damaging 1.00
R2215:Sec14l2 UTSW 11 4109169 missense probably damaging 1.00
R5301:Sec14l2 UTSW 11 4118727 start gained probably benign
R5668:Sec14l2 UTSW 11 4109189 missense probably damaging 1.00
R5949:Sec14l2 UTSW 11 4108972 missense probably damaging 1.00
R6050:Sec14l2 UTSW 11 4111477 missense probably benign 0.36
R6369:Sec14l2 UTSW 11 4103962 missense possibly damaging 0.69
R6467:Sec14l2 UTSW 11 4111161 missense probably damaging 1.00
R6798:Sec14l2 UTSW 11 4111213 missense probably damaging 1.00
R7142:Sec14l2 UTSW 11 4098379 missense probably benign 0.04
R7385:Sec14l2 UTSW 11 4116750 nonsense probably null
R7594:Sec14l2 UTSW 11 4111213 missense probably damaging 1.00
R7704:Sec14l2 UTSW 11 4108574 missense probably benign 0.19
R8438:Sec14l2 UTSW 11 4109202 nonsense probably null
R9307:Sec14l2 UTSW 11 4118665 missense probably benign 0.01
T0722:Sec14l2 UTSW 11 4103673 critical splice donor site probably null
X0067:Sec14l2 UTSW 11 4116737 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATCCACGTCTTTCCCGG -3'
(R):5'- GAAACTGGGGCCTCCTTTTC -3'

Sequencing Primer
(F):5'- TCCCGGGTTCACTGGTC -3'
(R):5'- CAGGTCCTTTTAGGGGTCACC -3'
Posted On 2014-08-25