Incidental Mutation 'R1976:Zfp786'
ID221701
Institutional Source Beutler Lab
Gene Symbol Zfp786
Ensembl Gene ENSMUSG00000051499
Gene Namezinc finger protein 786
SynonymsA730012O14Rik
MMRRC Submission 039989-MU
Accession Numbers

Genbank: NM_177882; MGI: 3026883

Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R1976 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location47819266-47830867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 47819757 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 749 (H749L)
Ref Sequence ENSEMBL: ENSMUSP00000057495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058844]
Predicted Effect probably damaging
Transcript: ENSMUST00000058844
AA Change: H749L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057495
Gene: ENSMUSG00000051499
AA Change: H749L

DomainStartEndE-ValueType
KRAB 9 69 2.6e-22 SMART
low complexity region 156 164 N/A INTRINSIC
ZnF_C2H2 240 262 5.34e-1 SMART
ZnF_C2H2 268 295 1.41e2 SMART
ZnF_C2H2 420 440 1.21e2 SMART
ZnF_C2H2 448 470 3.52e-1 SMART
ZnF_C2H2 476 498 1.89e-1 SMART
ZnF_C2H2 504 526 1.69e-3 SMART
ZnF_C2H2 532 554 5.59e-4 SMART
ZnF_C2H2 560 582 4.79e-3 SMART
ZnF_C2H2 588 610 3.69e-4 SMART
ZnF_C2H2 616 638 3.63e-3 SMART
ZnF_C2H2 644 665 5.92e0 SMART
ZnF_C2H2 671 693 2.57e-3 SMART
ZnF_C2H2 699 721 1.38e-3 SMART
ZnF_C2H2 727 749 1.45e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000080603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143979
Meta Mutation Damage Score 0.8910 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A C 7: 34,257,380 N353K probably damaging Het
Abca13 T C 11: 9,397,815 V3556A probably damaging Het
Abcb5 T C 12: 118,890,682 I833V probably benign Het
Adgrd1 A T 5: 129,140,797 H432L probably benign Het
Alppl2 T A 1: 87,088,741 I204F probably damaging Het
Ascc3 T A 10: 50,649,166 F486I probably damaging Het
Bcl9l T A 9: 44,506,152 L429Q possibly damaging Het
Ccdc33 A T 9: 58,117,162 Y227* probably null Het
Cd101 A G 3: 101,008,061 V730A probably damaging Het
Cdadc1 A T 14: 59,573,768 V431E probably damaging Het
Dazap1 T A 10: 80,274,620 probably null Het
Dbpht2 T A 12: 74,295,861 noncoding transcript Het
Dennd4b A T 3: 90,273,055 T742S probably damaging Het
Dhtkd1 T C 2: 5,902,391 E838G possibly damaging Het
Dync2h1 A T 9: 7,129,045 D1823E probably benign Het
Enox1 T A 14: 77,668,793 N556K probably benign Het
Fam227a T C 15: 79,626,276 I392M possibly damaging Het
Fnip2 A T 3: 79,480,931 M831K probably benign Het
Foxn1 T C 11: 78,365,937 probably benign Het
Glis3 T C 19: 28,262,677 probably benign Het
Gm4953 T A 1: 159,168,353 noncoding transcript Het
Gsr T G 8: 33,680,260 probably null Het
Habp4 G T 13: 64,184,606 V344F probably benign Het
Hdac7 G A 15: 97,806,505 Q495* probably null Het
Helb T C 10: 120,094,263 D737G possibly damaging Het
Hltf A G 3: 20,106,446 D759G probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Itsn2 A G 12: 4,672,733 probably benign Het
Kank2 A T 9: 21,794,561 V387E probably damaging Het
Lefty1 T C 1: 180,937,824 V319A probably benign Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Lpcat2b A T 5: 107,433,850 K348N possibly damaging Het
Lsamp T C 16: 41,889,067 V103A probably damaging Het
Ltbp4 A T 7: 27,326,770 C538S probably damaging Het
Micu1 T C 10: 59,768,213 S174P probably damaging Het
Mta1 A G 12: 113,136,306 N607S probably damaging Het
Muc5b C T 7: 141,863,154 S3279L probably benign Het
Naalad2 T C 9: 18,378,699 E211G probably damaging Het
Nup155 T A 15: 8,135,827 M649K probably benign Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Pisd A G 5: 32,738,865 V372A probably damaging Het
Prim1 T A 10: 128,023,799 C288S probably benign Het
Rab23 T A 1: 33,723,938 C30S probably damaging Het
Sacs A G 14: 61,202,895 T797A probably benign Het
Sall3 T C 18: 80,971,893 D940G probably benign Het
Scn1a T C 2: 66,331,271 E311G probably benign Het
Sdk1 T A 5: 142,143,818 I1598N probably damaging Het
Slc22a17 A T 14: 54,908,500 probably null Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Sprr3 T A 3: 92,456,946 Q197L possibly damaging Het
Stab2 A C 10: 86,896,496 probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tas2r123 T A 6: 132,847,332 V64D probably damaging Het
Trhde T G 10: 114,588,431 N483T possibly damaging Het
Trp53 C T 11: 69,588,497 T167M probably damaging Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Usp17la A G 7: 104,860,320 E44G possibly damaging Het
Usp40 T G 1: 87,978,536 Q659P probably benign Het
Vmn1r4 T C 6: 56,956,738 C76R probably damaging Het
Vmn2r118 C T 17: 55,592,925 G660R probably damaging Het
Zcchc11 T C 4: 108,479,523 L148P probably benign Het
Other mutations in Zfp786
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Zfp786 APN 6 47819671 makesense probably null
IGL02442:Zfp786 APN 6 47821367 missense probably benign 0.00
IGL02674:Zfp786 APN 6 47820493 missense probably benign 0.22
IGL02814:Zfp786 APN 6 47819841 missense probably damaging 1.00
IGL03072:Zfp786 APN 6 47821243 missense probably benign 0.01
IGL03294:Zfp786 APN 6 47821324 nonsense probably null
IGL03393:Zfp786 APN 6 47821524 missense possibly damaging 0.88
3-1:Zfp786 UTSW 6 47820445 missense probably damaging 1.00
PIT4581001:Zfp786 UTSW 6 47819822 missense probably damaging 1.00
R1071:Zfp786 UTSW 6 47821305 missense possibly damaging 0.91
R1426:Zfp786 UTSW 6 47825079 missense probably benign 0.17
R2114:Zfp786 UTSW 6 47826997 missense probably damaging 1.00
R2115:Zfp786 UTSW 6 47826997 missense probably damaging 1.00
R2117:Zfp786 UTSW 6 47826997 missense probably damaging 1.00
R2176:Zfp786 UTSW 6 47820971 missense possibly damaging 0.65
R2304:Zfp786 UTSW 6 47820699 missense probably damaging 1.00
R3110:Zfp786 UTSW 6 47820226 missense probably damaging 1.00
R3112:Zfp786 UTSW 6 47820226 missense probably damaging 1.00
R3623:Zfp786 UTSW 6 47821423 missense probably benign 0.00
R4654:Zfp786 UTSW 6 47820934 missense probably benign 0.01
R4741:Zfp786 UTSW 6 47820691 missense probably damaging 1.00
R4927:Zfp786 UTSW 6 47820153 missense probably benign 0.43
R4936:Zfp786 UTSW 6 47821268 nonsense probably null
R5084:Zfp786 UTSW 6 47820019 missense probably benign 0.00
R5445:Zfp786 UTSW 6 47819685 missense probably damaging 1.00
R6662:Zfp786 UTSW 6 47826986 missense probably damaging 1.00
R7290:Zfp786 UTSW 6 47819995 missense probably damaging 1.00
R7561:Zfp786 UTSW 6 47819733 missense probably benign 0.02
R8038:Zfp786 UTSW 6 47821254 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCTAAAACCTGCTTCCCAG -3'
(R):5'- GCCAAGCAATCTAAACTCGTGG -3'

Sequencing Primer
(F):5'- TGCTTCCCAGTAGGCTCAG -3'
(R):5'- GCTTCCGATTGAAAGCTCAG -3'
Posted On2014-08-25