Mutagenetix > Incidental Mutation

Incidental Mutation 'R2044:Dnah2'

221702

Institutional Source

Beutler Lab

Gene Symbol

Dnah2

Ensembl Gene

ENSMUSG00000005237

Gene Name

dynein, axonemal, heavy chain 2

Synonyms

Dnahc2, Dnhd3, D330014H01Rik, 2900022L05Rik

MMRRC Submission

040051-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2044 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

69420809-69549110 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 69524240 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 223 (S223P)

Ref Sequence

ENSEMBL: ENSMUSP00000104299 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035539] [ENSMUST00000108659]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000035539
AA Change: S223P

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000047329
Gene: ENSMUSG00000005237
AA Change: S223P

Domain	Start	End	E-Value	Type
low complexity region	4	25	N/A	INTRINSIC
Pfam:DHC_N1	273	429	6.6e-37	PFAM
Pfam:DHC_N1	432	761	1.3e-54	PFAM
Pfam:DHC_N2	1253	1668	3.4e-144	PFAM
AAA	1826	1962	2.95e-1	SMART
Pfam:AAA_5	2108	2251	1.3e-5	PFAM
AAA	2437	2584	3.63e-5	SMART
Pfam:AAA_8	2752	3022	1.1e-75	PFAM
Pfam:MT	3034	3370	8.7e-55	PFAM
Pfam:AAA_9	3386	3616	7.4e-68	PFAM
Pfam:Dynein_heavy	3748	4453	1.2e-220	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108659
AA Change: S223P

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000104299
Gene: ENSMUSG00000005237
AA Change: S223P

Domain	Start	End	E-Value	Type
low complexity region	4	25	N/A	INTRINSIC
Pfam:DHC_N1	274	429	1.1e-47	PFAM
Pfam:DHC_N1	438	760	1.5e-75	PFAM
Pfam:DHC_N2	1255	1666	4.4e-144	PFAM
low complexity region	1711	1720	N/A	INTRINSIC
AAA	1832	1968	2.95e-1	SMART
Blast:AAA	2111	2251	2e-86	BLAST
AAA	2443	2590	3.63e-5	SMART
Pfam:AAA_8	2758	3028	5.5e-77	PFAM
Pfam:MT	3040	3376	7.6e-55	PFAM
Pfam:AAA_9	3396	3621	7.5e-94	PFAM
Pfam:Dynein_heavy	3759	4458	4.9e-264	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149991

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.7%

Validation Efficiency

98% (92/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH2 is an axonemal inner arm dynein heavy chain (Chapelin et al., 1997 [PubMed 9256245]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410137M14Rik	G	A	17: 36,978,094		probably benign	Het
Abhd15	A	G	11: 77,518,338	T293A	probably benign	Het
Aldh1l1	C	T	6: 90,562,665	P192L	probably benign	Het
Aldoart1	T	G	4: 72,852,542	I10L	probably benign	Het
Ankhd1	G	A	18: 36,645,113	G1653D	probably benign	Het
Ankk1	A	C	9: 49,419,364		probably null	Het
Astn1	A	G	1: 158,600,502	T748A	possibly damaging	Het
Bmp7	C	A	2: 172,939,915	R52L	possibly damaging	Het
Ccdc151	T	G	9: 21,991,858	T419P	possibly damaging	Het
Ccdc33	G	A	9: 58,031,112	P859S	possibly damaging	Het
Ccny	A	G	18: 9,449,644	S10P	probably damaging	Het
Cdc6	C	A	11: 98,910,461	F179L	probably benign	Het
Cdc7	T	A	5: 106,983,132	V491E	probably benign	Het
Cdh23	G	T	10: 60,596,730	S138R	possibly damaging	Het
Cenpc1	T	C	5: 86,037,755	H299R	probably benign	Het
Ciart	A	T	3: 95,878,701	M354K	probably benign	Het
Clasrp	G	T	7: 19,586,715		probably benign	Het
Col4a3	G	A	1: 82,696,319	G1132E	unknown	Het
Crebbp	G	A	16: 4,084,823	T2184I	probably benign	Het
Cyp2r1	A	C	7: 114,550,405	M458R	probably damaging	Het
Cyp7a1	C	A	4: 6,275,492	R27M	probably null	Het
Ddhd2	A	G	8: 25,752,165	F116L	probably damaging	Het
Dgkd	G	A	1: 87,927,691	R685K	probably benign	Het
Exph5	A	T	9: 53,372,679	R353S	possibly damaging	Het
F11	C	A	8: 45,252,118	V129F	probably benign	Het
F830045P16Rik	A	T	2: 129,459,397	S454T	possibly damaging	Het
Fam124a	T	C	14: 62,587,207	I50T	probably damaging	Het
Fam20c	T	C	5: 138,756,227		probably null	Het
Fam234b	A	G	6: 135,226,914	T405A	probably benign	Het
Fbxo18	C	A	2: 11,762,970	V356L	possibly damaging	Het
Flywch1	G	A	17: 23,762,313	Q132*	probably null	Het
Foxo6	T	C	4: 120,286,969	D95G	probably benign	Het
Ggt5	T	C	10: 75,604,087	F174S	probably damaging	Het
Gm7104	G	A	12: 88,285,781		noncoding transcript	Het
Gpr155	A	G	2: 73,373,633	L279P	probably damaging	Het
H2-T23	A	G	17: 36,032,191	L98P	probably damaging	Het
Heatr5a	A	G	12: 51,955,403	V250A	probably benign	Het
Heyl	A	T	4: 123,241,363	I50F	probably damaging	Het
Hist4h4	G	C	6: 136,804,103	R93G	possibly damaging	Het
Ifitm10	A	T	7: 142,356,034	S179R	probably damaging	Het
Isg15	A	T	4: 156,199,792	I93N	probably benign	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Itga10	G	A	3: 96,657,690	V985I	probably benign	Het
Kcnt2	T	C	1: 140,375,154	I144T	probably benign	Het
Klk1	A	C	7: 44,229,034	K104T	possibly damaging	Het
Lemd3	C	A	10: 120,933,442	R654L	probably damaging	Het
Lmod1	A	T	1: 135,364,387	M327L	probably benign	Het
Lonrf2	T	C	1: 38,807,050	E347G	probably benign	Het
Ltbp1	A	G	17: 75,276,432	Y409C	probably damaging	Het
Mecom	A	T	3: 29,980,592	Y312N	probably damaging	Het
Mrgprb3	C	T	7: 48,643,734	C23Y	possibly damaging	Het
Mut	A	G	17: 40,941,451	T295A	probably benign	Het
Nadk	C	A	4: 155,585,441	L194I	probably damaging	Het
Naxd	A	G	8: 11,509,510	I182V	probably benign	Het
Nbeal1	T	A	1: 60,319,687	I1176K	probably damaging	Het
Nol4l	C	A	2: 153,529,521	R81L	possibly damaging	Het
Olfr1297	T	A	2: 111,621,814	R87W	probably benign	Het
Olfr1411	G	T	1: 92,596,969	R150L	probably benign	Het
Olfr957	A	T	9: 39,511,378	M114K	probably damaging	Het
Pcdh18	A	G	3: 49,754,940	V642A	probably benign	Het
Pdzk1	G	A	3: 96,855,848		probably benign	Het
Per3	C	T	4: 151,033,938	V233I	probably benign	Het
Pisd	G	A	5: 32,764,796	P267S	possibly damaging	Het
Prm1	T	A	16: 10,796,493		probably benign	Het
Ptprj	A	G	2: 90,463,095	V548A	probably damaging	Het
Ranbp3	G	A	17: 56,673,367		probably benign	Het
Raver2	T	A	4: 101,102,812	V163D	probably damaging	Het
Rbm14	A	T	19: 4,803,877	I159N	possibly damaging	Het
Rfx6	G	A	10: 51,718,126	V381I	probably benign	Het
Rhobtb1	T	C	10: 69,272,863		probably benign	Het
Rpl28-ps4	T	A	6: 117,213,895		noncoding transcript	Het
Rsph10b	A	G	5: 143,967,250		probably null	Het
Rspo4	A	G	2: 151,873,093	K217E	unknown	Het
Scgb2b27	G	A	7: 34,013,285	A44V	possibly damaging	Het
Sec14l2	G	A	11: 4,111,435		probably benign	Het
Sec31b	T	C	19: 44,536,156	N101D	probably benign	Het
Sema6a	A	T	18: 47,306,429	C9*	probably null	Het
Sept5	A	C	16: 18,623,012	L331R	probably benign	Het
Slc16a11	C	A	11: 70,215,651	Y238*	probably null	Het
Slc25a12	T	C	2: 71,312,548	T210A	probably benign	Het
Slc35f1	A	T	10: 53,089,347	Y286F	probably damaging	Het
Szt2	A	T	4: 118,376,448	L2225*	probably null	Het
Thap12	T	C	7: 98,716,620	L665P	probably damaging	Het
Tpsb2	T	A	17: 25,367,724	W237R	probably damaging	Het
Tyk2	T	C	9: 21,120,341	D451G	probably damaging	Het
Ube2j1	T	A	4: 33,049,696	N231K	probably benign	Het
Vmn1r225	A	T	17: 20,502,590	T98S	possibly damaging	Het
Vmn1r87	A	T	7: 13,131,821	S180T	probably benign	Het
Vmn2r6	A	G	3: 64,537,841	V821A	probably damaging	Het
Zfp689	C	A	7: 127,444,826	G211C	probably damaging	Het
Zfp827	A	G	8: 79,076,236	D479G	probably benign	Het
Zfp995	A	C	17: 21,880,594	F220V	probably damaging	Het

Other mutations in Dnah2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Dnah2	APN	11	69492672	missense	possibly damaging	0.93
IGL00418:Dnah2	APN	11	69495066	splice site	probably benign
IGL00772:Dnah2	APN	11	69451257	missense	probably damaging	0.97
IGL00819:Dnah2	APN	11	69473350	critical splice donor site	probably null
IGL00827:Dnah2	APN	11	69448457	missense	probably damaging	1.00
IGL01060:Dnah2	APN	11	69478092	missense	possibly damaging	0.86
IGL01340:Dnah2	APN	11	69493184	missense	probably damaging	0.99
IGL01349:Dnah2	APN	11	69475606	missense	probably damaging	0.99
IGL01413:Dnah2	APN	11	69432964	missense	probably damaging	0.99
IGL01451:Dnah2	APN	11	69474191	splice site	probably benign
IGL01480:Dnah2	APN	11	69458371	missense	possibly damaging	0.91
IGL01537:Dnah2	APN	11	69516080	missense	probably benign	0.17
IGL01592:Dnah2	APN	11	69431087	missense	probably benign	0.14
IGL01612:Dnah2	APN	11	69465063	splice site	probably benign
IGL01667:Dnah2	APN	11	69544395	missense	probably benign
IGL01667:Dnah2	APN	11	69520941	missense	probably damaging	0.98
IGL01691:Dnah2	APN	11	69539443	missense	probably benign
IGL02019:Dnah2	APN	11	69474285	missense	probably damaging	1.00
IGL02039:Dnah2	APN	11	69499212	missense	probably damaging	1.00
IGL02076:Dnah2	APN	11	69422559	missense	probably damaging	0.99
IGL02085:Dnah2	APN	11	69458185	missense	probably benign	0.07
IGL02158:Dnah2	APN	11	69458123	missense	probably benign
IGL02381:Dnah2	APN	11	69446292	missense	probably benign	0.25
IGL02681:Dnah2	APN	11	69452933	missense	probably benign	0.40
IGL02957:Dnah2	APN	11	69448507	missense	possibly damaging	0.96
IGL02961:Dnah2	APN	11	69518414	missense	probably damaging	1.00
IGL02969:Dnah2	APN	11	69521187	missense	possibly damaging	0.80
IGL03117:Dnah2	APN	11	69436291	splice site	probably benign
IGL03120:Dnah2	APN	11	69421848	missense	probably damaging	1.00
IGL03183:Dnah2	APN	11	69458488	missense	possibly damaging	0.94
IGL03197:Dnah2	APN	11	69459263	missense	probably damaging	1.00
IGL03263:Dnah2	APN	11	69529381	critical splice donor site	probably null
IGL03333:Dnah2	APN	11	69495123	missense	probably damaging	1.00
IGL03338:Dnah2	APN	11	69496577	missense	probably benign	0.13
argyrios	UTSW	11	69516590	missense	possibly damaging	0.47
Aureus	UTSW	11	69429348	missense	probably damaging	1.00
platinum	UTSW	11	69458042	missense	probably damaging	0.96
R0334_dnah2_144	UTSW	11	69436836	missense	probably damaging	1.00
R2150_dnah2_212	UTSW	11	69515761	missense	probably benign	0.14
BB005:Dnah2	UTSW	11	69430835	missense	probably damaging	0.98
BB015:Dnah2	UTSW	11	69430835	missense	probably damaging	0.98
E0370:Dnah2	UTSW	11	69515615	splice site	probably null
P0026:Dnah2	UTSW	11	69464947	missense	probably damaging	1.00
R0133:Dnah2	UTSW	11	69421009	missense	probably damaging	1.00
R0190:Dnah2	UTSW	11	69435249	missense	probably damaging	1.00
R0334:Dnah2	UTSW	11	69436836	missense	probably damaging	1.00
R0359:Dnah2	UTSW	11	69529531	missense	probably benign	0.00
R0386:Dnah2	UTSW	11	69447861	missense	probably damaging	1.00
R0414:Dnah2	UTSW	11	69499238	missense	probably benign	0.26
R0427:Dnah2	UTSW	11	69452879	missense	probably damaging	0.99
R0433:Dnah2	UTSW	11	69459288	missense	probably damaging	1.00
R0442:Dnah2	UTSW	11	69448542	missense	probably damaging	1.00
R0462:Dnah2	UTSW	11	69459201	missense	probably damaging	1.00
R0463:Dnah2	UTSW	11	69423126	missense	probably damaging	1.00
R0611:Dnah2	UTSW	11	69499194	missense	probably damaging	1.00
R0626:Dnah2	UTSW	11	69477683	missense	probably benign	0.07
R0924:Dnah2	UTSW	11	69421308	missense	probably damaging	1.00
R0968:Dnah2	UTSW	11	69448519	missense	possibly damaging	0.67
R1066:Dnah2	UTSW	11	69447819	missense	probably damaging	1.00
R1183:Dnah2	UTSW	11	69446648	missense	possibly damaging	0.95
R1184:Dnah2	UTSW	11	69499190	missense	probably damaging	1.00
R1186:Dnah2	UTSW	11	69515700	missense	probably damaging	0.99
R1453:Dnah2	UTSW	11	69451050	missense	probably damaging	0.99
R1498:Dnah2	UTSW	11	69520667	splice site	probably null
R1538:Dnah2	UTSW	11	69477202	missense	probably benign	0.17
R1574:Dnah2	UTSW	11	69514688	missense	probably benign	0.26
R1574:Dnah2	UTSW	11	69514688	missense	probably benign	0.26
R1590:Dnah2	UTSW	11	69422754	critical splice donor site	probably null
R1590:Dnah2	UTSW	11	69521198	missense	probably benign	0.00
R1655:Dnah2	UTSW	11	69473854	missense	probably damaging	1.00
R1695:Dnah2	UTSW	11	69514691	missense	possibly damaging	0.74
R1726:Dnah2	UTSW	11	69497889	missense	probably damaging	1.00
R1764:Dnah2	UTSW	11	69423543	missense	probably damaging	1.00
R1815:Dnah2	UTSW	11	69475574	missense	probably damaging	1.00
R1822:Dnah2	UTSW	11	69514804	missense	probably damaging	1.00
R1859:Dnah2	UTSW	11	69437886	missense	probably damaging	0.99
R1911:Dnah2	UTSW	11	69515752	missense	possibly damaging	0.64
R1913:Dnah2	UTSW	11	69464930	missense	probably damaging	1.00
R1981:Dnah2	UTSW	11	69474325	missense	probably damaging	1.00
R2010:Dnah2	UTSW	11	69458358	critical splice donor site	probably null
R2016:Dnah2	UTSW	11	69437070	missense	probably damaging	0.97
R2017:Dnah2	UTSW	11	69437070	missense	probably damaging	0.97
R2077:Dnah2	UTSW	11	69496606	missense	possibly damaging	0.73
R2096:Dnah2	UTSW	11	69455916	missense	probably damaging	0.98
R2099:Dnah2	UTSW	11	69493237	missense	probably damaging	1.00
R2127:Dnah2	UTSW	11	69458185	missense	probably benign	0.02
R2128:Dnah2	UTSW	11	69458185	missense	probably benign	0.02
R2146:Dnah2	UTSW	11	69515761	missense	probably benign	0.14
R2147:Dnah2	UTSW	11	69515761	missense	probably benign	0.14
R2150:Dnah2	UTSW	11	69515761	missense	probably benign	0.14
R2404:Dnah2	UTSW	11	69437221	missense	probably damaging	0.99
R2510:Dnah2	UTSW	11	69524206	nonsense	probably null
R2517:Dnah2	UTSW	11	69516644	missense	probably damaging	1.00
R3014:Dnah2	UTSW	11	69430478	missense	probably benign
R3741:Dnah2	UTSW	11	69448469	missense	probably damaging	1.00
R3814:Dnah2	UTSW	11	69492650	splice site	probably null
R3872:Dnah2	UTSW	11	69429348	missense	probably damaging	1.00
R3873:Dnah2	UTSW	11	69429348	missense	probably damaging	1.00
R3874:Dnah2	UTSW	11	69429348	missense	probably damaging	1.00
R3875:Dnah2	UTSW	11	69429348	missense	probably damaging	1.00
R3881:Dnah2	UTSW	11	69451347	missense	possibly damaging	0.94
R3953:Dnah2	UTSW	11	69454103	missense	probably damaging	1.00
R3956:Dnah2	UTSW	11	69484021	missense	probably benign	0.00
R4501:Dnah2	UTSW	11	69477659	missense	probably benign
R4515:Dnah2	UTSW	11	69465631	missense	possibly damaging	0.61
R4612:Dnah2	UTSW	11	69483367	missense	possibly damaging	0.93
R4625:Dnah2	UTSW	11	69463661	missense	probably damaging	1.00
R4627:Dnah2	UTSW	11	69465376	missense	probably damaging	1.00
R4642:Dnah2	UTSW	11	69496559	missense	probably benign	0.00
R4683:Dnah2	UTSW	11	69458942	missense	probably damaging	1.00
R4698:Dnah2	UTSW	11	69498532	missense	probably damaging	1.00
R4710:Dnah2	UTSW	11	69478077	missense	probably damaging	1.00
R4712:Dnah2	UTSW	11	69516590	missense	possibly damaging	0.47
R4713:Dnah2	UTSW	11	69476688	missense	probably damaging	1.00
R4717:Dnah2	UTSW	11	69429357	missense	probably benign	0.00
R4740:Dnah2	UTSW	11	69458042	missense	probably damaging	0.96
R4780:Dnah2	UTSW	11	69473871	missense	probably damaging	0.97
R4825:Dnah2	UTSW	11	69423205	missense	probably damaging	1.00
R4864:Dnah2	UTSW	11	69422590	missense	probably damaging	0.98
R4868:Dnah2	UTSW	11	69463648	missense	probably damaging	1.00
R4879:Dnah2	UTSW	11	69476691	missense	probably damaging	1.00
R4908:Dnah2	UTSW	11	69521147	missense	probably benign	0.00
R4911:Dnah2	UTSW	11	69499104	critical splice donor site	probably null
R4954:Dnah2	UTSW	11	69539496	missense	possibly damaging	0.61
R4962:Dnah2	UTSW	11	69455973	nonsense	probably null
R5015:Dnah2	UTSW	11	69497882	missense	possibly damaging	0.89
R5049:Dnah2	UTSW	11	69448166	missense	probably damaging	1.00
R5055:Dnah2	UTSW	11	69520773	missense	possibly damaging	0.67
R5153:Dnah2	UTSW	11	69520933	missense	possibly damaging	0.84
R5155:Dnah2	UTSW	11	69422536	missense	probably damaging	1.00
R5186:Dnah2	UTSW	11	69435884	missense	probably damaging	1.00
R5187:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5208:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5252:Dnah2	UTSW	11	69529469	missense	probably damaging	0.98
R5296:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5298:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5299:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5301:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5324:Dnah2	UTSW	11	69457993	missense	probably benign	0.07
R5350:Dnah2	UTSW	11	69516036	missense	possibly damaging	0.48
R5377:Dnah2	UTSW	11	69421848	missense	probably damaging	1.00
R5393:Dnah2	UTSW	11	69500857	missense	probably benign
R5421:Dnah2	UTSW	11	69435636	missense	probably damaging	1.00
R5452:Dnah2	UTSW	11	69524383	missense	probably damaging	1.00
R5461:Dnah2	UTSW	11	69473351	critical splice donor site	probably null
R5474:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5476:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5477:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5510:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5527:Dnah2	UTSW	11	69437188	nonsense	probably null
R5566:Dnah2	UTSW	11	69516569	nonsense	probably null
R5587:Dnah2	UTSW	11	69437242	missense	probably damaging	1.00
R5628:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5688:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5690:Dnah2	UTSW	11	69491544	missense	probably benign	0.15
R5711:Dnah2	UTSW	11	69435390	missense	probably damaging	1.00
R5735:Dnah2	UTSW	11	69430817	missense	possibly damaging	0.93
R5826:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5913:Dnah2	UTSW	11	69448430	missense	probably damaging	1.00
R5914:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5960:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5961:Dnah2	UTSW	11	69431148	missense	probably damaging	1.00
R5961:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5977:Dnah2	UTSW	11	69520881	missense	possibly damaging	0.79
R6020:Dnah2	UTSW	11	69500839	missense	probably benign
R6036:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R6036:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R6050:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R6086:Dnah2	UTSW	11	69516008	missense	probably benign	0.30
R6115:Dnah2	UTSW	11	69446649	missense	probably damaging	1.00
R6123:Dnah2	UTSW	11	69518359	missense	probably benign	0.29
R6159:Dnah2	UTSW	11	69458542	missense	probably damaging	1.00
R6159:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R6163:Dnah2	UTSW	11	69520903	nonsense	probably null
R6171:Dnah2	UTSW	11	69423042	missense	probably damaging	1.00
R6263:Dnah2	UTSW	11	69457412	missense	probably damaging	1.00
R6298:Dnah2	UTSW	11	69491641	missense	probably benign	0.25
R6352:Dnah2	UTSW	11	69448227	missense	probably damaging	1.00
R6399:Dnah2	UTSW	11	69458518	missense	probably damaging	0.98
R6466:Dnah2	UTSW	11	69539415	missense	probably benign
R6478:Dnah2	UTSW	11	69516010	missense	probably benign	0.01
R6516:Dnah2	UTSW	11	69465386	missense	probably benign	0.34
R6538:Dnah2	UTSW	11	69437197	missense	possibly damaging	0.87
R6802:Dnah2	UTSW	11	69423690	missense	probably damaging	1.00
R6861:Dnah2	UTSW	11	69455963	missense	possibly damaging	0.64
R6869:Dnah2	UTSW	11	69429471	missense	probably damaging	1.00
R6894:Dnah2	UTSW	11	69484260	missense	probably benign	0.12
R6935:Dnah2	UTSW	11	69421741	missense	probably damaging	1.00
R7017:Dnah2	UTSW	11	69491547	nonsense	probably null
R7073:Dnah2	UTSW	11	69430492	nonsense	probably null
R7111:Dnah2	UTSW	11	69446753	splice site	probably null
R7125:Dnah2	UTSW	11	69436182	missense	probably damaging	0.99
R7137:Dnah2	UTSW	11	69491555	missense	probably damaging	1.00
R7190:Dnah2	UTSW	11	69549097	splice site	probably null
R7214:Dnah2	UTSW	11	69431109	missense	probably damaging	1.00
R7227:Dnah2	UTSW	11	69421396	missense	probably damaging	0.99
R7238:Dnah2	UTSW	11	69459146	critical splice donor site	probably null
R7256:Dnah2	UTSW	11	69431094	missense	probably damaging	1.00
R7267:Dnah2	UTSW	11	69500817	missense	probably damaging	1.00
R7420:Dnah2	UTSW	11	69478797	missense	possibly damaging	0.94
R7421:Dnah2	UTSW	11	69492805	missense	probably benign	0.25
R7437:Dnah2	UTSW	11	69498627	missense	probably damaging	1.00
R7461:Dnah2	UTSW	11	69548990	critical splice donor site	probably null
R7473:Dnah2	UTSW	11	69491658	missense	probably damaging	0.99
R7528:Dnah2	UTSW	11	69500796	missense	probably damaging	0.99
R7613:Dnah2	UTSW	11	69548990	critical splice donor site	probably null
R7615:Dnah2	UTSW	11	69435304	missense	probably damaging	0.99
R7626:Dnah2	UTSW	11	69498685	missense	probably damaging	0.99
R7745:Dnah2	UTSW	11	69451318	nonsense	probably null
R7764:Dnah2	UTSW	11	69458158	missense	probably benign	0.29
R7793:Dnah2	UTSW	11	69495214	missense	probably benign	0.00
R7819:Dnah2	UTSW	11	69516593	missense	probably benign	0.01
R7881:Dnah2	UTSW	11	69431238	missense	probably damaging	1.00
R7900:Dnah2	UTSW	11	69518428	missense	probably damaging	1.00
R7916:Dnah2	UTSW	11	69421148	critical splice acceptor site	probably null
R7921:Dnah2	UTSW	11	69520834	missense	probably benign
R7928:Dnah2	UTSW	11	69430835	missense	probably damaging	0.98
R7937:Dnah2	UTSW	11	69517685	nonsense	probably null
R7995:Dnah2	UTSW	11	69520737	missense	possibly damaging	0.77
R8202:Dnah2	UTSW	11	69478823	missense	probably benign	0.00
R8208:Dnah2	UTSW	11	69520852	missense	probably benign	0.05
R8215:Dnah2	UTSW	11	69435367	missense	probably damaging	1.00
R8279:Dnah2	UTSW	11	69475573	missense	probably damaging	1.00
R8338:Dnah2	UTSW	11	69487296	missense	probably damaging	1.00
R8348:Dnah2	UTSW	11	69429447	missense	possibly damaging	0.95
R8405:Dnah2	UTSW	11	69458463	missense	probably damaging	1.00
R8407:Dnah2	UTSW	11	69459278	missense	probably benign	0.00
R8493:Dnah2	UTSW	11	69452978	missense	probably damaging	1.00
R8673:Dnah2	UTSW	11	69514697	missense	probably benign	0.23
R8725:Dnah2	UTSW	11	69524179	missense	probably damaging	1.00
R8727:Dnah2	UTSW	11	69524179	missense	probably damaging	1.00
R8730:Dnah2	UTSW	11	69493261	missense	possibly damaging	0.73
R8804:Dnah2	UTSW	11	69465685	missense	probably benign	0.01
R8876:Dnah2	UTSW	11	69491522	missense	probably damaging	1.00
R8894:Dnah2	UTSW	11	69492222	missense	probably benign	0.01
R8938:Dnah2	UTSW	11	69437928	missense	probably damaging	0.99
R9044:Dnah2	UTSW	11	69529421	missense	probably benign
R9085:Dnah2	UTSW	11	69429398	missense	possibly damaging	0.69
R9110:Dnah2	UTSW	11	69544382	missense	probably benign
R9156:Dnah2	UTSW	11	69422861	missense
R9251:Dnah2	UTSW	11	69515793	missense	probably damaging	1.00
R9258:Dnah2	UTSW	11	69477253	missense	probably damaging	1.00
R9279:Dnah2	UTSW	11	69518278	missense	probably benign	0.01
R9318:Dnah2	UTSW	11	69484329	missense	probably benign	0.07
R9321:Dnah2	UTSW	11	69448113	critical splice donor site	probably null
R9350:Dnah2	UTSW	11	69493247	missense	probably benign	0.10
R9358:Dnah2	UTSW	11	69515766	missense	probably damaging	0.99
R9417:Dnah2	UTSW	11	69436164	missense	probably damaging	1.00
R9420:Dnah2	UTSW	11	69478116	missense	probably benign	0.09
R9438:Dnah2	UTSW	11	69473394	missense	probably damaging	1.00
R9469:Dnah2	UTSW	11	69431070	missense	probably damaging	1.00
R9487:Dnah2	UTSW	11	69515791	missense	possibly damaging	0.47
R9495:Dnah2	UTSW	11	69454382	missense	possibly damaging	0.89
R9579:Dnah2	UTSW	11	69477215	missense	probably damaging	1.00
R9608:Dnah2	UTSW	11	69454062	missense	probably null	1.00
R9651:Dnah2	UTSW	11	69450998	critical splice donor site	probably null
R9662:Dnah2	UTSW	11	69452937	missense	probably benign
RF004:Dnah2	UTSW	11	69437187	missense	probably benign	0.24
U24488:Dnah2	UTSW	11	69483822	missense	probably damaging	0.99
X0021:Dnah2	UTSW	11	69448562	missense	possibly damaging	0.81
Z1088:Dnah2	UTSW	11	69430793	missense	probably damaging	1.00
Z1176:Dnah2	UTSW	11	69421821	missense	possibly damaging	0.46
Z1176:Dnah2	UTSW	11	69451120	missense	probably benign
Z1176:Dnah2	UTSW	11	69487054	missense	possibly damaging	0.46
Z1176:Dnah2	UTSW	11	69498667	missense	probably benign	0.12
Z1176:Dnah2	UTSW	11	69516481	missense	probably damaging	1.00
Z1176:Dnah2	UTSW	11	69516523	missense	probably damaging	1.00
Z1177:Dnah2	UTSW	11	69463453	missense	possibly damaging	0.63
Z1177:Dnah2	UTSW	11	69544557	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGATTGTGCACACGTGAGG -3'
(R):5'- TCAGAGACCTTTGGGCATCC -3'

Sequencing Primer
(F):5'- TGCACACGTGAGGCCTTAGTG -3'
(R):5'- GCATCCTGGAGACTGAACTCTGATC -3'

Posted On

2014-08-25