Incidental Mutation 'R1976:Kank2'
ID221723
Institutional Source Beutler Lab
Gene Symbol Kank2
Ensembl Gene ENSMUSG00000032194
Gene NameKN motif and ankyrin repeat domains 2
SynonymsAnkrd25
MMRRC Submission 039989-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R1976 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21766784-21798744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21794561 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 387 (V387E)
Ref Sequence ENSEMBL: ENSMUSP00000151181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034717] [ENSMUST00000213691] [ENSMUST00000216008]
Predicted Effect probably damaging
Transcript: ENSMUST00000034717
AA Change: V387E

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034717
Gene: ENSMUSG00000032194
AA Change: V387E

DomainStartEndE-ValueType
Pfam:KN_motif 31 69 9.6e-26 PFAM
low complexity region 139 157 N/A INTRINSIC
coiled coil region 213 229 N/A INTRINSIC
coiled coil region 284 316 N/A INTRINSIC
low complexity region 324 343 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
ANK 658 688 6.36e-3 SMART
ANK 692 725 7.29e2 SMART
ANK 730 759 4.97e-5 SMART
ANK 763 793 3.85e-2 SMART
ANK 797 825 1.06e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213691
Predicted Effect probably damaging
Transcript: ENSMUST00000216008
AA Change: V387E

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.1847 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KN motif and ankyrin repeat domains (KANK) family of proteins, which play a role in cytoskeletal formation by regulating actin polymerization. The encoded protein functions in the sequestration of steroid receptor coactivators and possibly other proteins. Mutations in this gene are associated with impaired kidney podocyte function and nephrotic syndrome, and keratoderma and woolly hair. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A C 7: 34,257,380 N353K probably damaging Het
Abca13 T C 11: 9,397,815 V3556A probably damaging Het
Abcb5 T C 12: 118,890,682 I833V probably benign Het
Adgrd1 A T 5: 129,140,797 H432L probably benign Het
Alppl2 T A 1: 87,088,741 I204F probably damaging Het
Ascc3 T A 10: 50,649,166 F486I probably damaging Het
Bcl9l T A 9: 44,506,152 L429Q possibly damaging Het
Ccdc33 A T 9: 58,117,162 Y227* probably null Het
Cd101 A G 3: 101,008,061 V730A probably damaging Het
Cdadc1 A T 14: 59,573,768 V431E probably damaging Het
Dazap1 T A 10: 80,274,620 probably null Het
Dbpht2 T A 12: 74,295,861 noncoding transcript Het
Dennd4b A T 3: 90,273,055 T742S probably damaging Het
Dhtkd1 T C 2: 5,902,391 E838G possibly damaging Het
Dync2h1 A T 9: 7,129,045 D1823E probably benign Het
Enox1 T A 14: 77,668,793 N556K probably benign Het
Fam227a T C 15: 79,626,276 I392M possibly damaging Het
Fnip2 A T 3: 79,480,931 M831K probably benign Het
Foxn1 T C 11: 78,365,937 probably benign Het
Glis3 T C 19: 28,262,677 probably benign Het
Gm4953 T A 1: 159,168,353 noncoding transcript Het
Gsr T G 8: 33,680,260 probably null Het
Habp4 G T 13: 64,184,606 V344F probably benign Het
Hdac7 G A 15: 97,806,505 Q495* probably null Het
Helb T C 10: 120,094,263 D737G possibly damaging Het
Hltf A G 3: 20,106,446 D759G probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Itsn2 A G 12: 4,672,733 probably benign Het
Lefty1 T C 1: 180,937,824 V319A probably benign Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Lpcat2b A T 5: 107,433,850 K348N possibly damaging Het
Lsamp T C 16: 41,889,067 V103A probably damaging Het
Ltbp4 A T 7: 27,326,770 C538S probably damaging Het
Micu1 T C 10: 59,768,213 S174P probably damaging Het
Mta1 A G 12: 113,136,306 N607S probably damaging Het
Muc5b C T 7: 141,863,154 S3279L probably benign Het
Naalad2 T C 9: 18,378,699 E211G probably damaging Het
Nup155 T A 15: 8,135,827 M649K probably benign Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Pisd A G 5: 32,738,865 V372A probably damaging Het
Prim1 T A 10: 128,023,799 C288S probably benign Het
Rab23 T A 1: 33,723,938 C30S probably damaging Het
Sacs A G 14: 61,202,895 T797A probably benign Het
Sall3 T C 18: 80,971,893 D940G probably benign Het
Scn1a T C 2: 66,331,271 E311G probably benign Het
Sdk1 T A 5: 142,143,818 I1598N probably damaging Het
Slc22a17 A T 14: 54,908,500 probably null Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Sprr3 T A 3: 92,456,946 Q197L possibly damaging Het
Stab2 A C 10: 86,896,496 probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tas2r123 T A 6: 132,847,332 V64D probably damaging Het
Trhde T G 10: 114,588,431 N483T possibly damaging Het
Trp53 C T 11: 69,588,497 T167M probably damaging Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Usp17la A G 7: 104,860,320 E44G possibly damaging Het
Usp40 T G 1: 87,978,536 Q659P probably benign Het
Vmn1r4 T C 6: 56,956,738 C76R probably damaging Het
Vmn2r118 C T 17: 55,592,925 G660R probably damaging Het
Zcchc11 T C 4: 108,479,523 L148P probably benign Het
Zfp786 T A 6: 47,819,757 H749L probably damaging Het
Other mutations in Kank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Kank2 APN 9 21780479 splice site probably benign
IGL01574:Kank2 APN 9 21794604 missense probably damaging 1.00
IGL01624:Kank2 APN 9 21780380 missense probably damaging 1.00
IGL02752:Kank2 APN 9 21795033 missense probably damaging 1.00
IGL03116:Kank2 APN 9 21772764 missense probably damaging 0.96
IGL03133:Kank2 APN 9 21795641 missense probably null 0.82
IGL03384:Kank2 APN 9 21774578 missense possibly damaging 0.82
PIT4515001:Kank2 UTSW 9 21794883 missense probably benign
R0054:Kank2 UTSW 9 21774674 nonsense probably null
R0480:Kank2 UTSW 9 21779899 missense probably damaging 1.00
R1270:Kank2 UTSW 9 21772760 missense probably damaging 1.00
R1538:Kank2 UTSW 9 21774631 missense probably damaging 0.99
R1574:Kank2 UTSW 9 21774575 missense probably damaging 1.00
R1574:Kank2 UTSW 9 21774575 missense probably damaging 1.00
R1602:Kank2 UTSW 9 21769837 missense probably damaging 1.00
R1827:Kank2 UTSW 9 21795465 missense probably damaging 1.00
R1941:Kank2 UTSW 9 21772866 missense possibly damaging 0.69
R2276:Kank2 UTSW 9 21769784 missense probably damaging 1.00
R2278:Kank2 UTSW 9 21769784 missense probably damaging 1.00
R2303:Kank2 UTSW 9 21769765 missense probably benign 0.12
R4085:Kank2 UTSW 9 21795119 missense probably damaging 1.00
R4163:Kank2 UTSW 9 21795568 missense probably damaging 1.00
R4204:Kank2 UTSW 9 21795627 missense probably damaging 1.00
R4461:Kank2 UTSW 9 21794745 nonsense probably null
R4738:Kank2 UTSW 9 21774619 missense probably damaging 1.00
R4811:Kank2 UTSW 9 21775747 missense probably damaging 1.00
R4859:Kank2 UTSW 9 21779782 missense probably benign 0.13
R5838:Kank2 UTSW 9 21795393 missense probably damaging 0.99
R6449:Kank2 UTSW 9 21780562 missense possibly damaging 0.68
R7131:Kank2 UTSW 9 21794679 missense probably benign 0.02
Z1177:Kank2 UTSW 9 21795249 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCTCACTTTGATAGGCTGGG -3'
(R):5'- TAAAGTGGCCGTGTTGGAGAC -3'

Sequencing Primer
(F):5'- GGCCACCTGTTTAGCTCAG -3'
(R):5'- GTGTTGGAGACCCAGCTC -3'
Posted On2014-08-25