Incidental Mutation 'R1976:Pan2'
ID221746
Institutional Source Beutler Lab
Gene Symbol Pan2
Ensembl Gene ENSMUSG00000005682
Gene NamePAN2 poly(A) specific ribonuclease subunit
SynonymsUsp52, 1200014O24Rik
MMRRC Submission 039989-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1976 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128303335-128321358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128320413 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1171 (V1171A)
Ref Sequence ENSEMBL: ENSMUSP00000151216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005825] [ENSMUST00000026446] [ENSMUST00000218315] [ENSMUST00000219037] [ENSMUST00000219721] [ENSMUST00000219836]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005825
AA Change: V1180A

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000005825
Gene: ENSMUSG00000005682
AA Change: V1180A

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
SCOP:d1tbga_ 151 357 4e-11 SMART
Blast:WD40 225 271 4e-11 BLAST
low complexity region 412 425 N/A INTRINSIC
Pfam:UCH 515 920 2.6e-15 PFAM
Pfam:UCH_1 516 897 9.7e-70 PFAM
low complexity region 938 949 N/A INTRINSIC
EXOIII 972 1155 1.68e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026446
SMART Domains Protein: ENSMUSP00000026446
Gene: ENSMUSG00000025381

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF3456 27 171 1e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000218315
AA Change: V1171A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218496
Predicted Effect probably benign
Transcript: ENSMUST00000219037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219199
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219255
Predicted Effect probably damaging
Transcript: ENSMUST00000219721
AA Change: V1153A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000219836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220391
Meta Mutation Damage Score 0.2574 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deadenylase that functions as the catalytic subunit of the polyadenylate binding protein dependent poly(A) nuclease complex. The encoded protein is a magnesium dependent 3' to 5' exoribonuclease that is involved in the degradation of cytoplasmic mRNAs. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A C 7: 34,257,380 N353K probably damaging Het
Abca13 T C 11: 9,397,815 V3556A probably damaging Het
Abcb5 T C 12: 118,890,682 I833V probably benign Het
Adgrd1 A T 5: 129,140,797 H432L probably benign Het
Alppl2 T A 1: 87,088,741 I204F probably damaging Het
Ascc3 T A 10: 50,649,166 F486I probably damaging Het
Bcl9l T A 9: 44,506,152 L429Q possibly damaging Het
Ccdc33 A T 9: 58,117,162 Y227* probably null Het
Cd101 A G 3: 101,008,061 V730A probably damaging Het
Cdadc1 A T 14: 59,573,768 V431E probably damaging Het
Dazap1 T A 10: 80,274,620 probably null Het
Dbpht2 T A 12: 74,295,861 noncoding transcript Het
Dennd4b A T 3: 90,273,055 T742S probably damaging Het
Dhtkd1 T C 2: 5,902,391 E838G possibly damaging Het
Dync2h1 A T 9: 7,129,045 D1823E probably benign Het
Enox1 T A 14: 77,668,793 N556K probably benign Het
Fam227a T C 15: 79,626,276 I392M possibly damaging Het
Fnip2 A T 3: 79,480,931 M831K probably benign Het
Foxn1 T C 11: 78,365,937 probably benign Het
Glis3 T C 19: 28,262,677 probably benign Het
Gm4953 T A 1: 159,168,353 noncoding transcript Het
Gsr T G 8: 33,680,260 probably null Het
Habp4 G T 13: 64,184,606 V344F probably benign Het
Hdac7 G A 15: 97,806,505 Q495* probably null Het
Helb T C 10: 120,094,263 D737G possibly damaging Het
Hltf A G 3: 20,106,446 D759G probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Itsn2 A G 12: 4,672,733 probably benign Het
Kank2 A T 9: 21,794,561 V387E probably damaging Het
Lefty1 T C 1: 180,937,824 V319A probably benign Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Lpcat2b A T 5: 107,433,850 K348N possibly damaging Het
Lsamp T C 16: 41,889,067 V103A probably damaging Het
Ltbp4 A T 7: 27,326,770 C538S probably damaging Het
Micu1 T C 10: 59,768,213 S174P probably damaging Het
Mta1 A G 12: 113,136,306 N607S probably damaging Het
Muc5b C T 7: 141,863,154 S3279L probably benign Het
Naalad2 T C 9: 18,378,699 E211G probably damaging Het
Nup155 T A 15: 8,135,827 M649K probably benign Het
Pisd A G 5: 32,738,865 V372A probably damaging Het
Prim1 T A 10: 128,023,799 C288S probably benign Het
Rab23 T A 1: 33,723,938 C30S probably damaging Het
Sacs A G 14: 61,202,895 T797A probably benign Het
Sall3 T C 18: 80,971,893 D940G probably benign Het
Scn1a T C 2: 66,331,271 E311G probably benign Het
Sdk1 T A 5: 142,143,818 I1598N probably damaging Het
Slc22a17 A T 14: 54,908,500 probably null Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Sprr3 T A 3: 92,456,946 Q197L possibly damaging Het
Stab2 A C 10: 86,896,496 probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tas2r123 T A 6: 132,847,332 V64D probably damaging Het
Trhde T G 10: 114,588,431 N483T possibly damaging Het
Trp53 C T 11: 69,588,497 T167M probably damaging Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Usp17la A G 7: 104,860,320 E44G possibly damaging Het
Usp40 T G 1: 87,978,536 Q659P probably benign Het
Vmn1r4 T C 6: 56,956,738 C76R probably damaging Het
Vmn2r118 C T 17: 55,592,925 G660R probably damaging Het
Zcchc11 T C 4: 108,479,523 L148P probably benign Het
Zfp786 T A 6: 47,819,757 H749L probably damaging Het
Other mutations in Pan2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Pan2 APN 10 128312926 nonsense probably null
IGL02183:Pan2 APN 10 128309075 missense possibly damaging 0.74
IGL02219:Pan2 APN 10 128320352 missense probably benign 0.04
IGL02514:Pan2 APN 10 128310741 missense possibly damaging 0.94
IGL02552:Pan2 APN 10 128319027 missense probably damaging 1.00
IGL02623:Pan2 APN 10 128312899 missense probably benign
IGL02860:Pan2 APN 10 128310735 nonsense probably null
IGL03104:Pan2 APN 10 128315663 splice site probably benign
IGL03372:Pan2 APN 10 128315127 missense probably benign 0.09
R0541:Pan2 UTSW 10 128308222 missense possibly damaging 0.87
R0585:Pan2 UTSW 10 128310515 critical splice donor site probably null
R1079:Pan2 UTSW 10 128318238 missense probably damaging 0.99
R1650:Pan2 UTSW 10 128317899 missense probably damaging 1.00
R1847:Pan2 UTSW 10 128304378 missense possibly damaging 0.71
R1867:Pan2 UTSW 10 128313181 missense probably damaging 1.00
R1903:Pan2 UTSW 10 128308368 missense probably damaging 0.98
R1975:Pan2 UTSW 10 128320413 missense probably damaging 0.99
R1977:Pan2 UTSW 10 128320413 missense probably damaging 0.99
R2136:Pan2 UTSW 10 128313637 missense possibly damaging 0.95
R2162:Pan2 UTSW 10 128304222 missense possibly damaging 0.90
R2512:Pan2 UTSW 10 128304457 missense probably damaging 1.00
R2566:Pan2 UTSW 10 128313897 missense probably damaging 1.00
R2900:Pan2 UTSW 10 128308342 missense probably benign
R3957:Pan2 UTSW 10 128315177 missense probably damaging 0.99
R4571:Pan2 UTSW 10 128308643 missense probably benign 0.05
R5112:Pan2 UTSW 10 128315595 nonsense probably null
R5120:Pan2 UTSW 10 128314995 critical splice donor site probably null
R5183:Pan2 UTSW 10 128317969 missense probably damaging 1.00
R5325:Pan2 UTSW 10 128317634 missense possibly damaging 0.59
R5539:Pan2 UTSW 10 128308133 missense probably benign 0.16
R5642:Pan2 UTSW 10 128308100 missense probably benign 0.00
R5740:Pan2 UTSW 10 128308164 missense probably damaging 1.00
R5822:Pan2 UTSW 10 128320380 missense probably damaging 1.00
R6766:Pan2 UTSW 10 128314512 missense possibly damaging 0.79
R6902:Pan2 UTSW 10 128315637 missense probably benign 0.33
R6946:Pan2 UTSW 10 128315637 missense probably benign 0.33
R7206:Pan2 UTSW 10 128314545 nonsense probably null
R7490:Pan2 UTSW 10 128308440 missense probably benign 0.00
R7715:Pan2 UTSW 10 128317723 missense probably benign 0.00
R7794:Pan2 UTSW 10 128316527 splice site probably null
R8286:Pan2 UTSW 10 128318320 missense probably damaging 1.00
RF005:Pan2 UTSW 10 128315535 missense probably benign 0.00
RF024:Pan2 UTSW 10 128315535 missense probably benign 0.00
Z1177:Pan2 UTSW 10 128304410 missense possibly damaging 0.94
Z1177:Pan2 UTSW 10 128314499 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTGTACCCCAGACCTGAAGATTC -3'
(R):5'- GACATTTCCCTGAGCAAGCG -3'

Sequencing Primer
(F):5'- TTCAAGGTGAGACCCATGAC -3'
(R):5'- CACTGACTATTGGAAACACTGAGTG -3'
Posted On2014-08-25