Incidental Mutation 'R1976:Abcb5'
ID 221759
Institutional Source Beutler Lab
Gene Symbol Abcb5
Ensembl Gene ENSMUSG00000072791
Gene Name ATP-binding cassette, sub-family B member 5
Synonyms 9230106F14Rik
MMRRC Submission 039989-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.177) question?
Stock # R1976 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 118831559-118930156 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118854417 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 833 (I833V)
Ref Sequence ENSEMBL: ENSMUSP00000046177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035515]
AlphaFold B5X0E4
Predicted Effect probably benign
Transcript: ENSMUST00000035515
AA Change: I833V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791
AA Change: I833V

DomainStartEndE-ValueType
Pfam:ABC_membrane 49 338 1.9e-74 PFAM
AAA 414 606 2.1e-19 SMART
Pfam:ABC_membrane 693 967 7.3e-59 PFAM
Blast:AAA 969 1040 2e-11 BLAST
AAA 1043 1231 8.26e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177311
Meta Mutation Damage Score 0.0917 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,347,815 (GRCm39) V3556A probably damaging Het
Adgrd1 A T 5: 129,217,861 (GRCm39) H432L probably benign Het
Alppl2 T A 1: 87,016,463 (GRCm39) I204F probably damaging Het
Ascc3 T A 10: 50,525,262 (GRCm39) F486I probably damaging Het
Bcl9l T A 9: 44,417,449 (GRCm39) L429Q possibly damaging Het
Ccdc33 A T 9: 58,024,445 (GRCm39) Y227* probably null Het
Cd101 A G 3: 100,915,377 (GRCm39) V730A probably damaging Het
Cdadc1 A T 14: 59,811,217 (GRCm39) V431E probably damaging Het
Dazap1 T A 10: 80,110,454 (GRCm39) probably null Het
Dbpht2 T A 12: 74,342,635 (GRCm39) noncoding transcript Het
Dennd4b A T 3: 90,180,362 (GRCm39) T742S probably damaging Het
Dhtkd1 T C 2: 5,907,202 (GRCm39) E838G possibly damaging Het
Dync2h1 A T 9: 7,129,045 (GRCm39) D1823E probably benign Het
Enox1 T A 14: 77,906,233 (GRCm39) N556K probably benign Het
Fam227a T C 15: 79,510,477 (GRCm39) I392M possibly damaging Het
Fnip2 A T 3: 79,388,238 (GRCm39) M831K probably benign Het
Foxn1 T C 11: 78,256,763 (GRCm39) probably benign Het
Garre1 A C 7: 33,956,805 (GRCm39) N353K probably damaging Het
Glis3 T C 19: 28,240,077 (GRCm39) 936 probably benign Het
Gm4953 T A 1: 158,995,923 (GRCm39) noncoding transcript Het
Gsr T G 8: 34,170,288 (GRCm39) probably null Het
Habp4 G T 13: 64,332,420 (GRCm39) V344F probably benign Het
Hdac7 G A 15: 97,704,386 (GRCm39) Q495* probably null Het
Helb T C 10: 119,930,168 (GRCm39) D737G possibly damaging Het
Hltf A G 3: 20,160,610 (GRCm39) D759G probably damaging Het
Hlx G T 1: 184,464,184 (GRCm39) A52D probably damaging Het
Itga10 C T 3: 96,559,054 (GRCm39) probably benign Het
Itsn2 A G 12: 4,722,733 (GRCm39) probably benign Het
Kank2 A T 9: 21,705,857 (GRCm39) V387E probably damaging Het
Lefty1 T C 1: 180,765,389 (GRCm39) V319A probably benign Het
Lonp1 T C 17: 56,922,068 (GRCm39) T771A possibly damaging Het
Lpcat2b A T 5: 107,581,716 (GRCm39) K348N possibly damaging Het
Lsamp T C 16: 41,709,430 (GRCm39) V103A probably damaging Het
Ltbp4 A T 7: 27,026,195 (GRCm39) C538S probably damaging Het
Micu1 T C 10: 59,604,035 (GRCm39) S174P probably damaging Het
Mta1 A G 12: 113,099,926 (GRCm39) N607S probably damaging Het
Muc5b C T 7: 141,416,891 (GRCm39) S3279L probably benign Het
Naalad2 T C 9: 18,289,995 (GRCm39) E211G probably damaging Het
Nup155 T A 15: 8,165,311 (GRCm39) M649K probably benign Het
Pan2 T C 10: 128,156,282 (GRCm39) V1171A probably damaging Het
Pisd A G 5: 32,896,209 (GRCm39) V372A probably damaging Het
Prim1 T A 10: 127,859,668 (GRCm39) C288S probably benign Het
Rab23 T A 1: 33,763,019 (GRCm39) C30S probably damaging Het
Sacs A G 14: 61,440,344 (GRCm39) T797A probably benign Het
Sall3 T C 18: 81,015,108 (GRCm39) D940G probably benign Het
Scn1a T C 2: 66,161,615 (GRCm39) E311G probably benign Het
Sdk1 T A 5: 142,129,573 (GRCm39) I1598N probably damaging Het
Slc22a17 A T 14: 55,145,957 (GRCm39) probably null Het
Slc36a4 T A 9: 15,645,506 (GRCm39) V311D probably damaging Het
Sprr3 T A 3: 92,364,253 (GRCm39) Q197L possibly damaging Het
Stab2 A C 10: 86,732,360 (GRCm39) probably null Het
Stk4 C T 2: 163,942,448 (GRCm39) T360M probably benign Het
Tas2r123 T A 6: 132,824,295 (GRCm39) V64D probably damaging Het
Trhde T G 10: 114,424,336 (GRCm39) N483T possibly damaging Het
Trp53 C T 11: 69,479,323 (GRCm39) T167M probably damaging Het
Tspan8 A G 10: 115,680,035 (GRCm39) I217V probably benign Het
Tut4 T C 4: 108,336,720 (GRCm39) L148P probably benign Het
Usp17la A G 7: 104,509,527 (GRCm39) E44G possibly damaging Het
Usp40 T G 1: 87,906,258 (GRCm39) Q659P probably benign Het
Vmn1r4 T C 6: 56,933,723 (GRCm39) C76R probably damaging Het
Vmn2r118 C T 17: 55,899,925 (GRCm39) G660R probably damaging Het
Zfp786 T A 6: 47,796,691 (GRCm39) H749L probably damaging Het
Other mutations in Abcb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Abcb5 APN 12 118,854,345 (GRCm39) missense probably benign 0.03
IGL00092:Abcb5 APN 12 118,892,430 (GRCm39) missense probably benign 0.09
IGL00503:Abcb5 APN 12 118,871,336 (GRCm39) missense probably benign 0.02
IGL00776:Abcb5 APN 12 118,883,589 (GRCm39) missense probably damaging 1.00
IGL01116:Abcb5 APN 12 118,849,911 (GRCm39) missense probably benign
IGL01302:Abcb5 APN 12 118,881,935 (GRCm39) missense probably damaging 1.00
IGL01403:Abcb5 APN 12 118,836,602 (GRCm39) missense probably damaging 1.00
IGL01453:Abcb5 APN 12 118,831,705 (GRCm39) missense probably damaging 1.00
IGL01541:Abcb5 APN 12 118,875,169 (GRCm39) missense probably benign 0.03
IGL01784:Abcb5 APN 12 118,854,399 (GRCm39) missense probably benign 0.14
IGL01967:Abcb5 APN 12 118,831,707 (GRCm39) missense probably damaging 1.00
IGL01987:Abcb5 APN 12 118,891,093 (GRCm39) missense probably damaging 1.00
IGL02104:Abcb5 APN 12 118,904,415 (GRCm39) missense probably damaging 1.00
IGL02161:Abcb5 APN 12 118,838,490 (GRCm39) missense probably benign
IGL02292:Abcb5 APN 12 118,881,932 (GRCm39) missense probably damaging 1.00
IGL02381:Abcb5 APN 12 118,904,413 (GRCm39) missense probably damaging 1.00
IGL02544:Abcb5 APN 12 118,870,003 (GRCm39) splice site probably benign
IGL02685:Abcb5 APN 12 118,869,682 (GRCm39) missense probably damaging 0.99
IGL02824:Abcb5 APN 12 118,854,420 (GRCm39) missense probably benign 0.05
IGL02876:Abcb5 APN 12 118,883,576 (GRCm39) missense probably damaging 1.00
IGL02929:Abcb5 APN 12 118,908,674 (GRCm39) missense probably damaging 0.99
IGL03030:Abcb5 APN 12 118,904,104 (GRCm39) missense possibly damaging 0.93
IGL03062:Abcb5 APN 12 118,899,822 (GRCm39) missense probably benign 0.43
IGL03200:Abcb5 APN 12 118,928,989 (GRCm39) splice site probably benign
IGL03407:Abcb5 APN 12 118,904,111 (GRCm39) missense probably benign 0.01
alphabet UTSW 12 118,854,353 (GRCm39) missense possibly damaging 0.67
google UTSW 12 118,831,665 (GRCm39) missense possibly damaging 0.93
F5770:Abcb5 UTSW 12 118,849,914 (GRCm39) missense probably benign 0.07
PIT4366001:Abcb5 UTSW 12 118,899,833 (GRCm39) missense probably damaging 1.00
PIT4434001:Abcb5 UTSW 12 118,854,422 (GRCm39) missense probably damaging 1.00
R0078:Abcb5 UTSW 12 118,891,129 (GRCm39) missense probably benign
R0219:Abcb5 UTSW 12 118,849,885 (GRCm39) splice site probably benign
R0312:Abcb5 UTSW 12 118,836,572 (GRCm39) missense probably damaging 1.00
R0347:Abcb5 UTSW 12 118,928,986 (GRCm39) splice site probably benign
R0359:Abcb5 UTSW 12 118,904,067 (GRCm39) missense probably damaging 1.00
R0433:Abcb5 UTSW 12 118,841,545 (GRCm39) missense probably benign 0.03
R0582:Abcb5 UTSW 12 118,904,147 (GRCm39) missense probably benign 0.40
R0815:Abcb5 UTSW 12 118,865,184 (GRCm39) splice site probably benign
R0900:Abcb5 UTSW 12 118,904,359 (GRCm39) missense probably damaging 1.00
R0942:Abcb5 UTSW 12 118,869,933 (GRCm39) missense possibly damaging 0.94
R0988:Abcb5 UTSW 12 118,896,310 (GRCm39) missense probably benign 0.36
R1125:Abcb5 UTSW 12 118,875,282 (GRCm39) missense possibly damaging 0.87
R1437:Abcb5 UTSW 12 118,838,497 (GRCm39) missense probably damaging 0.99
R1469:Abcb5 UTSW 12 118,831,681 (GRCm39) missense possibly damaging 0.83
R1469:Abcb5 UTSW 12 118,831,681 (GRCm39) missense possibly damaging 0.83
R1678:Abcb5 UTSW 12 118,929,064 (GRCm39) start gained probably benign
R1726:Abcb5 UTSW 12 118,871,267 (GRCm39) missense possibly damaging 0.95
R1726:Abcb5 UTSW 12 118,838,536 (GRCm39) splice site probably null
R1836:Abcb5 UTSW 12 118,831,696 (GRCm39) missense possibly damaging 0.93
R1934:Abcb5 UTSW 12 118,871,235 (GRCm39) splice site probably null
R2005:Abcb5 UTSW 12 118,841,562 (GRCm39) missense probably benign 0.15
R2068:Abcb5 UTSW 12 118,904,303 (GRCm39) nonsense probably null
R2181:Abcb5 UTSW 12 118,831,681 (GRCm39) missense possibly damaging 0.83
R2191:Abcb5 UTSW 12 118,831,691 (GRCm39) missense probably damaging 1.00
R3690:Abcb5 UTSW 12 118,836,668 (GRCm39) missense probably damaging 1.00
R3746:Abcb5 UTSW 12 118,838,355 (GRCm39) missense probably damaging 0.99
R3825:Abcb5 UTSW 12 118,865,087 (GRCm39) splice site probably null
R3919:Abcb5 UTSW 12 118,854,353 (GRCm39) missense possibly damaging 0.67
R4049:Abcb5 UTSW 12 118,832,404 (GRCm39) missense probably damaging 0.99
R4409:Abcb5 UTSW 12 118,836,657 (GRCm39) missense probably damaging 0.98
R4606:Abcb5 UTSW 12 118,896,345 (GRCm39) critical splice acceptor site probably null
R4705:Abcb5 UTSW 12 118,929,040 (GRCm39) missense possibly damaging 0.95
R4954:Abcb5 UTSW 12 118,875,169 (GRCm39) missense probably benign 0.03
R4966:Abcb5 UTSW 12 118,850,626 (GRCm39) intron probably benign
R5169:Abcb5 UTSW 12 118,841,552 (GRCm39) nonsense probably null
R5327:Abcb5 UTSW 12 118,875,278 (GRCm39) missense probably benign 0.01
R5333:Abcb5 UTSW 12 118,831,677 (GRCm39) missense probably damaging 1.00
R5366:Abcb5 UTSW 12 118,831,665 (GRCm39) missense possibly damaging 0.93
R5373:Abcb5 UTSW 12 118,850,912 (GRCm39) missense probably damaging 1.00
R5399:Abcb5 UTSW 12 118,875,234 (GRCm39) missense probably benign
R5416:Abcb5 UTSW 12 118,871,331 (GRCm39) missense probably damaging 1.00
R5447:Abcb5 UTSW 12 118,891,061 (GRCm39) missense probably damaging 1.00
R5474:Abcb5 UTSW 12 118,904,425 (GRCm39) missense probably null 1.00
R5566:Abcb5 UTSW 12 118,899,702 (GRCm39) missense probably damaging 0.99
R5685:Abcb5 UTSW 12 118,896,348 (GRCm39) splice site probably null
R5691:Abcb5 UTSW 12 118,890,970 (GRCm39) missense probably damaging 0.99
R5742:Abcb5 UTSW 12 118,881,992 (GRCm39) missense probably damaging 0.96
R5852:Abcb5 UTSW 12 118,891,139 (GRCm39) missense probably damaging 0.99
R5917:Abcb5 UTSW 12 118,832,516 (GRCm39) nonsense probably null
R5994:Abcb5 UTSW 12 118,928,995 (GRCm39) critical splice donor site probably null
R6295:Abcb5 UTSW 12 118,838,379 (GRCm39) missense probably damaging 0.99
R6455:Abcb5 UTSW 12 118,854,284 (GRCm39) critical splice donor site probably null
R6609:Abcb5 UTSW 12 118,892,497 (GRCm39) missense probably damaging 1.00
R6753:Abcb5 UTSW 12 118,908,641 (GRCm39) missense possibly damaging 0.86
R6818:Abcb5 UTSW 12 118,865,089 (GRCm39) splice site probably null
R6870:Abcb5 UTSW 12 118,929,000 (GRCm39) missense possibly damaging 0.87
R6944:Abcb5 UTSW 12 118,875,265 (GRCm39) missense probably benign 0.06
R6957:Abcb5 UTSW 12 118,871,270 (GRCm39) missense probably damaging 1.00
R6984:Abcb5 UTSW 12 118,891,012 (GRCm39) missense possibly damaging 0.47
R7021:Abcb5 UTSW 12 118,895,660 (GRCm39) missense probably benign 0.00
R7061:Abcb5 UTSW 12 118,841,509 (GRCm39) missense probably damaging 1.00
R7175:Abcb5 UTSW 12 118,831,611 (GRCm39) missense probably benign 0.00
R7239:Abcb5 UTSW 12 118,892,460 (GRCm39) missense probably benign 0.19
R7267:Abcb5 UTSW 12 118,916,205 (GRCm39) missense probably damaging 1.00
R7303:Abcb5 UTSW 12 118,875,295 (GRCm39) missense probably damaging 0.96
R7396:Abcb5 UTSW 12 118,831,609 (GRCm39) missense probably damaging 1.00
R7605:Abcb5 UTSW 12 118,881,899 (GRCm39) missense probably damaging 1.00
R7989:Abcb5 UTSW 12 118,875,278 (GRCm39) missense probably benign 0.01
R8177:Abcb5 UTSW 12 118,836,525 (GRCm39) missense possibly damaging 0.65
R8296:Abcb5 UTSW 12 118,838,467 (GRCm39) missense probably benign 0.01
R8544:Abcb5 UTSW 12 118,832,461 (GRCm39) missense probably damaging 1.00
R8558:Abcb5 UTSW 12 118,841,566 (GRCm39) missense probably benign 0.07
R8790:Abcb5 UTSW 12 118,831,620 (GRCm39) missense possibly damaging 0.91
R9003:Abcb5 UTSW 12 118,850,013 (GRCm39) missense possibly damaging 0.93
R9038:Abcb5 UTSW 12 118,895,651 (GRCm39) missense probably benign
R9410:Abcb5 UTSW 12 118,869,703 (GRCm39) missense probably benign 0.00
R9497:Abcb5 UTSW 12 118,899,850 (GRCm39) missense probably damaging 0.96
R9666:Abcb5 UTSW 12 118,838,422 (GRCm39) missense probably damaging 0.98
R9682:Abcb5 UTSW 12 118,896,328 (GRCm39) missense probably damaging 0.99
R9756:Abcb5 UTSW 12 118,881,873 (GRCm39) missense probably damaging 0.98
V7580:Abcb5 UTSW 12 118,849,914 (GRCm39) missense probably benign 0.07
Z1176:Abcb5 UTSW 12 118,882,007 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGGTTGCCATCCTAAGGG -3'
(R):5'- GTCTCAATACTGCATGTAAGGTTG -3'

Sequencing Primer
(F):5'- GCCATCCTAAGGGTTTTGTATAAC -3'
(R):5'- TGAAAGGATTCCTTAACTAGGTTTTC -3'
Posted On 2014-08-25