Incidental Mutation 'R2045:Itga10'
ID221779
Institutional Source Beutler Lab
Gene Symbol Itga10
Ensembl Gene ENSMUSG00000090210
Gene Nameintegrin, alpha 10
Synonyms
MMRRC Submission 040052-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R2045 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96645584-96664519 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 96651738 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000119365] [ENSMUST00000137564]
Predicted Effect probably benign
Transcript: ENSMUST00000029744
SMART Domains Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1123 1145 N/A INTRINSIC
low complexity region 1153 1166 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119365
SMART Domains Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1122 1144 N/A INTRINSIC
low complexity region 1152 1165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137564
SMART Domains Protein: ENSMUSP00000121011
Gene: ENSMUSG00000106447

DomainStartEndE-ValueType
Pfam:PEX11 1 172 4.5e-57 PFAM
low complexity region 186 204 N/A INTRINSIC
Int_alpha 222 278 9.03e-3 SMART
Blast:VWA 292 345 3e-7 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,399 G303E probably damaging Het
Adamts1 A T 16: 85,795,976 Y515N probably damaging Het
Ankef1 T C 2: 136,554,738 V695A probably benign Het
Ankrd63 C A 2: 118,703,353 probably benign Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Atf2 A C 2: 73,863,208 D3E probably damaging Het
Atp5f1 T C 3: 105,943,874 probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 A C 6: 118,392,627 L960W probably damaging Het
Cacna1c A G 6: 118,656,137 V977A probably damaging Het
Cadps2 A G 6: 23,839,122 S6P possibly damaging Het
Capn8 A G 1: 182,613,386 T462A probably benign Het
Cd226 T C 18: 89,207,362 S128P probably benign Het
Cd33 G T 7: 43,529,892 H278N probably benign Het
Cdh1 T C 8: 106,666,182 probably benign Het
Cfap54 T C 10: 93,038,809 probably null Het
Chit1 A G 1: 134,151,144 I397M probably benign Het
Cic C A 7: 25,271,536 Q231K possibly damaging Het
Clca4b A G 3: 144,925,163 V312A probably damaging Het
Cngb1 T A 8: 95,297,085 probably null Het
Cyfip2 T C 11: 46,249,789 I430V probably benign Het
Dnah12 A G 14: 26,781,528 E1613G probably null Het
Dock2 T C 11: 34,294,106 probably null Het
Dync2h1 A T 9: 7,160,171 F646I probably damaging Het
Eef1b2 A T 1: 63,179,487 K144* probably null Het
Erap1 T C 13: 74,669,450 V137A probably benign Het
Fam196a T G 7: 134,918,430 K124Q probably damaging Het
Far1 A T 7: 113,539,271 probably null Het
Fbn2 A T 18: 58,090,658 C807S probably damaging Het
Fgfr1 A G 8: 25,558,215 K209R probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Frem2 A T 3: 53,535,744 V2533D probably damaging Het
Hip1r T C 5: 124,000,731 M839T probably benign Het
Igfbp2 A G 1: 72,852,151 S303G probably benign Het
Itgb3 T G 11: 104,623,413 S27A probably benign Het
Kif21b G A 1: 136,160,313 D1015N probably damaging Het
Krt7 A T 15: 101,423,484 probably null Het
Krtdap T A 7: 30,790,585 F80L probably benign Het
Lcp1 A T 14: 75,200,401 T84S probably benign Het
Lipi G A 16: 75,550,199 T444I probably damaging Het
Lrguk A T 6: 34,071,068 E316V probably damaging Het
Lypd1 G A 1: 125,910,535 probably benign Het
Med12l A T 3: 59,262,310 K1632* probably null Het
Mrgpra9 A T 7: 47,235,835 M28K probably benign Het
Mylk A G 16: 34,953,653 K1291E probably benign Het
Nek4 T A 14: 30,953,923 W72R probably damaging Het
Nudt8 T C 19: 4,001,899 V170A probably damaging Het
Oosp3 T A 19: 11,699,369 Y31N probably benign Het
Padi2 A T 4: 140,937,930 R449W probably damaging Het
Pcf11 G T 7: 92,661,879 N300K probably damaging Het
Pcsk5 T C 19: 17,581,144 D633G possibly damaging Het
Phlpp2 T A 8: 109,907,600 W271R probably damaging Het
Pikfyve T C 1: 65,253,353 V1276A probably benign Het
Pkhd1l1 A T 15: 44,479,654 N176Y probably damaging Het
Pop5 T G 5: 115,238,212 V33G possibly damaging Het
Prkag2 A G 5: 24,947,582 F175L possibly damaging Het
Ptpn22 T A 3: 103,874,021 D79E possibly damaging Het
Rab32 T G 10: 10,550,833 D123A probably damaging Het
Rnpc3 T C 3: 113,608,360 K513E possibly damaging Het
Senp1 A T 15: 98,059,944 F358I possibly damaging Het
Sft2d2 A G 1: 165,185,078 L83P probably damaging Het
Slc9c1 G A 16: 45,580,250 R741H probably damaging Het
Smad4 A T 18: 73,649,806 Y352* probably null Het
Tamm41 T A 6: 115,016,095 Q232H probably benign Het
Tbx6 T A 7: 126,782,883 L131Q probably damaging Het
Trappc10 T C 10: 78,209,479 probably benign Het
Trp53bp1 C A 2: 121,204,483 A108S probably benign Het
Unc13b G A 4: 43,091,266 V31M probably damaging Het
Usp24 T C 4: 106,400,980 M1525T possibly damaging Het
Vax2 G A 6: 83,711,270 probably benign Het
Vcan T A 13: 89,690,985 I2147L probably benign Het
Zbtb7a C A 10: 81,144,410 A146E probably benign Het
Zcchc6 T C 13: 59,800,656 Y215C probably damaging Het
Zfp287 A G 11: 62,727,569 L157P probably damaging Het
Other mutations in Itga10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Itga10 APN 3 96647641 missense probably damaging 0.96
IGL01694:Itga10 APN 3 96652517 missense probably damaging 0.99
IGL01754:Itga10 APN 3 96656775 unclassified probably benign
IGL02527:Itga10 APN 3 96655624 unclassified probably benign
IGL02956:Itga10 APN 3 96655113 missense possibly damaging 0.46
IGL03371:Itga10 APN 3 96654788 missense possibly damaging 0.84
IGL03055:Itga10 UTSW 3 96650520 missense probably damaging 0.99
PIT4515001:Itga10 UTSW 3 96662632 missense probably damaging 0.99
R0153:Itga10 UTSW 3 96653700 missense probably benign 0.00
R0308:Itga10 UTSW 3 96651464 missense probably damaging 1.00
R0331:Itga10 UTSW 3 96652483 missense probably damaging 1.00
R0413:Itga10 UTSW 3 96649059 missense probably damaging 1.00
R0437:Itga10 UTSW 3 96649137 missense probably damaging 1.00
R0511:Itga10 UTSW 3 96658174 missense probably damaging 1.00
R0630:Itga10 UTSW 3 96656299 unclassified probably benign
R0844:Itga10 UTSW 3 96651738 splice site probably benign
R0849:Itga10 UTSW 3 96652530 missense possibly damaging 0.67
R0894:Itga10 UTSW 3 96653660 missense possibly damaging 0.69
R0919:Itga10 UTSW 3 96651738 splice site probably benign
R1027:Itga10 UTSW 3 96651738 splice site probably benign
R1341:Itga10 UTSW 3 96652495 missense probably damaging 1.00
R1350:Itga10 UTSW 3 96657477 missense probably benign 0.01
R1370:Itga10 UTSW 3 96651738 splice site probably benign
R1467:Itga10 UTSW 3 96652229 nonsense probably null
R1467:Itga10 UTSW 3 96652229 nonsense probably null
R1589:Itga10 UTSW 3 96651738 splice site probably benign
R1590:Itga10 UTSW 3 96651738 splice site probably benign
R1601:Itga10 UTSW 3 96653658 missense possibly damaging 0.82
R1659:Itga10 UTSW 3 96662977 missense probably damaging 0.96
R1665:Itga10 UTSW 3 96651738 splice site probably benign
R1667:Itga10 UTSW 3 96651738 splice site probably benign
R1686:Itga10 UTSW 3 96651825 missense probably damaging 0.97
R1972:Itga10 UTSW 3 96651738 splice site probably benign
R1976:Itga10 UTSW 3 96651738 splice site probably benign
R2020:Itga10 UTSW 3 96652490 missense probably damaging 1.00
R2040:Itga10 UTSW 3 96651738 splice site probably benign
R2044:Itga10 UTSW 3 96651738 splice site probably benign
R2044:Itga10 UTSW 3 96657690 missense probably benign
R2060:Itga10 UTSW 3 96654998 nonsense probably null
R2146:Itga10 UTSW 3 96651492 missense possibly damaging 0.59
R2146:Itga10 UTSW 3 96653723 missense probably damaging 1.00
R2170:Itga10 UTSW 3 96650457 missense probably damaging 1.00
R2893:Itga10 UTSW 3 96655100 missense probably benign 0.11
R2926:Itga10 UTSW 3 96652849 missense probably damaging 1.00
R3622:Itga10 UTSW 3 96651738 splice site probably benign
R3623:Itga10 UTSW 3 96651738 splice site probably benign
R4416:Itga10 UTSW 3 96658246 missense possibly damaging 0.58
R4633:Itga10 UTSW 3 96647704 missense possibly damaging 0.92
R5074:Itga10 UTSW 3 96652211 nonsense probably null
R5095:Itga10 UTSW 3 96648164 missense probably benign 0.21
R5495:Itga10 UTSW 3 96647371 missense possibly damaging 0.92
R5813:Itga10 UTSW 3 96652585 missense probably benign 0.38
R6114:Itga10 UTSW 3 96649035 missense probably damaging 1.00
R6172:Itga10 UTSW 3 96647437 missense probably benign 0.18
R6275:Itga10 UTSW 3 96658185 missense probably benign 0.36
R6298:Itga10 UTSW 3 96656762 missense probably benign 0.00
R6433:Itga10 UTSW 3 96658041 critical splice donor site probably null
R6841:Itga10 UTSW 3 96656714 missense probably damaging 1.00
R6909:Itga10 UTSW 3 96662599 missense probably benign 0.00
R6927:Itga10 UTSW 3 96656714 missense probably damaging 1.00
R7124:Itga10 UTSW 3 96651765 missense probably damaging 0.96
R7310:Itga10 UTSW 3 96648159 missense probably damaging 1.00
R7387:Itga10 UTSW 3 96652778 missense probably benign 0.11
R7464:Itga10 UTSW 3 96648155 missense probably damaging 1.00
R7624:Itga10 UTSW 3 96652953 missense probably benign
R7638:Itga10 UTSW 3 96657391 intron probably null
R7639:Itga10 UTSW 3 96649582 missense probably benign 0.36
R7893:Itga10 UTSW 3 96649612 missense probably damaging 1.00
R8297:Itga10 UTSW 3 96654800 missense probably damaging 1.00
X0064:Itga10 UTSW 3 96652936 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTACAGGTTGGATAGACCCTGAC -3'
(R):5'- ACTCTCTGTGACTCACCCAG -3'

Sequencing Primer
(F):5'- GGATAGACCCTGACCCTCTC -3'
(R):5'- TCTCTGTGACTCACCCAGGTAGG -3'
Posted On2014-08-25