Incidental Mutation 'R1976:Glis3'
ID221786
Institutional Source Beutler Lab
Gene Symbol Glis3
Ensembl Gene ENSMUSG00000052942
Gene NameGLIS family zinc finger 3
SynonymsE330013K21Rik, 4833409N03Rik
MMRRC Submission 039989-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R1976 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location28258851-28680077 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to C at 28262677 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065113] [ENSMUST00000162022]
Predicted Effect probably benign
Transcript: ENSMUST00000065113
SMART Domains Protein: ENSMUSP00000066953
Gene: ENSMUSG00000052942

DomainStartEndE-ValueType
low complexity region 35 53 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159639
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161026
Predicted Effect probably benign
Transcript: ENSMUST00000162022
SMART Domains Protein: ENSMUSP00000124635
Gene: ENSMUSG00000052942

DomainStartEndE-ValueType
low complexity region 35 53 N/A INTRINSIC
low complexity region 203 222 N/A INTRINSIC
low complexity region 438 476 N/A INTRINSIC
ZnF_C2H2 500 525 1.07e0 SMART
ZnF_C2H2 534 561 6.13e-1 SMART
ZnF_C2H2 567 591 3.89e-3 SMART
ZnF_C2H2 597 621 1.45e-2 SMART
ZnF_C2H2 627 651 9.08e-4 SMART
low complexity region 700 709 N/A INTRINSIC
low complexity region 722 746 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162873
Predicted Effect unknown
Transcript: ENSMUST00000172141
AA Change: M69V
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: This gene is a member of the GLI-similar zinc finger protein family and encodes a nuclear protein which contains multiple C2H2-type zinc finger domains. This protein functions as both a repressor and activator of transcription and is specifically involved in the transcriptional regulation of insulin. It is thought to enhance GLI-RE-dependent transcription by binding to the GLI-RE consensus sequence (GACCACCCAC). Mutations in a similar gene in human have been associated with neonatal diabetes and congenital hypothyroidism (NDH). Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit postnatal lethality associated with neonatal diabetes and polycystic kidney disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A C 7: 34,257,380 N353K probably damaging Het
Abca13 T C 11: 9,397,815 V3556A probably damaging Het
Abcb5 T C 12: 118,890,682 I833V probably benign Het
Adgrd1 A T 5: 129,140,797 H432L probably benign Het
Alppl2 T A 1: 87,088,741 I204F probably damaging Het
Ascc3 T A 10: 50,649,166 F486I probably damaging Het
Bcl9l T A 9: 44,506,152 L429Q possibly damaging Het
Ccdc33 A T 9: 58,117,162 Y227* probably null Het
Cd101 A G 3: 101,008,061 V730A probably damaging Het
Cdadc1 A T 14: 59,573,768 V431E probably damaging Het
Dazap1 T A 10: 80,274,620 probably null Het
Dbpht2 T A 12: 74,295,861 noncoding transcript Het
Dennd4b A T 3: 90,273,055 T742S probably damaging Het
Dhtkd1 T C 2: 5,902,391 E838G possibly damaging Het
Dync2h1 A T 9: 7,129,045 D1823E probably benign Het
Enox1 T A 14: 77,668,793 N556K probably benign Het
Fam227a T C 15: 79,626,276 I392M possibly damaging Het
Fnip2 A T 3: 79,480,931 M831K probably benign Het
Foxn1 T C 11: 78,365,937 probably benign Het
Gm4953 T A 1: 159,168,353 noncoding transcript Het
Gsr T G 8: 33,680,260 probably null Het
Habp4 G T 13: 64,184,606 V344F probably benign Het
Hdac7 G A 15: 97,806,505 Q495* probably null Het
Helb T C 10: 120,094,263 D737G possibly damaging Het
Hltf A G 3: 20,106,446 D759G probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Itsn2 A G 12: 4,672,733 probably benign Het
Kank2 A T 9: 21,794,561 V387E probably damaging Het
Lefty1 T C 1: 180,937,824 V319A probably benign Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Lpcat2b A T 5: 107,433,850 K348N possibly damaging Het
Lsamp T C 16: 41,889,067 V103A probably damaging Het
Ltbp4 A T 7: 27,326,770 C538S probably damaging Het
Micu1 T C 10: 59,768,213 S174P probably damaging Het
Mta1 A G 12: 113,136,306 N607S probably damaging Het
Muc5b C T 7: 141,863,154 S3279L probably benign Het
Naalad2 T C 9: 18,378,699 E211G probably damaging Het
Nup155 T A 15: 8,135,827 M649K probably benign Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Pisd A G 5: 32,738,865 V372A probably damaging Het
Prim1 T A 10: 128,023,799 C288S probably benign Het
Rab23 T A 1: 33,723,938 C30S probably damaging Het
Sacs A G 14: 61,202,895 T797A probably benign Het
Sall3 T C 18: 80,971,893 D940G probably benign Het
Scn1a T C 2: 66,331,271 E311G probably benign Het
Sdk1 T A 5: 142,143,818 I1598N probably damaging Het
Slc22a17 A T 14: 54,908,500 probably null Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Sprr3 T A 3: 92,456,946 Q197L possibly damaging Het
Stab2 A C 10: 86,896,496 probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tas2r123 T A 6: 132,847,332 V64D probably damaging Het
Trhde T G 10: 114,588,431 N483T possibly damaging Het
Trp53 C T 11: 69,588,497 T167M probably damaging Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Usp17la A G 7: 104,860,320 E44G possibly damaging Het
Usp40 T G 1: 87,978,536 Q659P probably benign Het
Vmn1r4 T C 6: 56,956,738 C76R probably damaging Het
Vmn2r118 C T 17: 55,592,925 G660R probably damaging Het
Zcchc11 T C 4: 108,479,523 L148P probably benign Het
Zfp786 T A 6: 47,819,757 H749L probably damaging Het
Other mutations in Glis3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Glis3 APN 19 28540264 missense probably damaging 1.00
IGL02240:Glis3 APN 19 28531525 missense probably damaging 1.00
IGL02347:Glis3 APN 19 28531883 missense probably benign
IGL02904:Glis3 APN 19 28357952 missense possibly damaging 0.58
glee UTSW 19 28262677 utr 3 prime probably benign
R0071:Glis3 UTSW 19 28263855 splice site probably benign
R0071:Glis3 UTSW 19 28263855 splice site probably benign
R0106:Glis3 UTSW 19 28531868 missense possibly damaging 0.67
R0106:Glis3 UTSW 19 28531868 missense possibly damaging 0.67
R0399:Glis3 UTSW 19 28298768 splice site probably benign
R1462:Glis3 UTSW 19 28262518 utr 3 prime probably benign
R1901:Glis3 UTSW 19 28531585 missense probably damaging 1.00
R1982:Glis3 UTSW 19 28531274 missense probably damaging 1.00
R2155:Glis3 UTSW 19 28531302 missense probably benign 0.16
R3723:Glis3 UTSW 19 28262591 nonsense probably null
R4496:Glis3 UTSW 19 28666127 missense possibly damaging 0.90
R4921:Glis3 UTSW 19 28666104 missense probably damaging 1.00
R5088:Glis3 UTSW 19 28531579 missense probably benign 0.00
R5241:Glis3 UTSW 19 28350023 missense probably benign 0.02
R5557:Glis3 UTSW 19 28264009 missense probably benign 0.00
R6226:Glis3 UTSW 19 28317302 missense probably damaging 1.00
R6309:Glis3 UTSW 19 28317361 missense probably benign 0.24
R6488:Glis3 UTSW 19 28298853 missense probably benign 0.13
R7069:Glis3 UTSW 19 28531519 missense probably damaging 1.00
R7260:Glis3 UTSW 19 28531402 missense probably benign
R7313:Glis3 UTSW 19 28531019 missense probably damaging 1.00
R7320:Glis3 UTSW 19 28531598 missense probably damaging 1.00
R7767:Glis3 UTSW 19 28263960 missense probably benign 0.18
R7839:Glis3 UTSW 19 28317373 missense possibly damaging 0.81
R7922:Glis3 UTSW 19 28317373 missense possibly damaging 0.81
T0970:Glis3 UTSW 19 28530932 missense probably damaging 1.00
Z1176:Glis3 UTSW 19 28283768 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCTTATTTTGCCATTGGAGAAGC -3'
(R):5'- ACTGGATAGTCAGACCTGGC -3'

Sequencing Primer
(F):5'- TTTGCCATTGGAGAAGCAACTG -3'
(R):5'- ATAGTCAGACCTGGCTTTCAG -3'
Posted On2014-08-25