Incidental Mutation 'R2045:Padi2'
ID221792
Institutional Source Beutler Lab
Gene Symbol Padi2
Ensembl Gene ENSMUSG00000028927
Gene Namepeptidyl arginine deiminase, type II
SynonymsPAD type II, Pdi, Pdi2
MMRRC Submission 040052-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R2045 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location140906344-140952586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 140937930 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 449 (R449W)
Ref Sequence ENSEMBL: ENSMUSP00000030765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030765]
Predicted Effect probably damaging
Transcript: ENSMUST00000030765
AA Change: R449W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030765
Gene: ENSMUSG00000028927
AA Change: R449W

DomainStartEndE-ValueType
Pfam:PAD_N 9 122 1.7e-36 PFAM
Pfam:PAD_M 124 282 4e-71 PFAM
Pfam:PAD 292 670 3.8e-174 PFAM
Meta Mutation Damage Score 0.0288 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. The type II enzyme is the most widely expressed family member. Known substrates for this enzyme include myelin basic protein in the central nervous system and vimentin in skeletal muscle and macrophages. This enzyme is thought to play a role in the onset and progression of neurodegenerative human disorders, including Alzheimer disease and multiple sclerosis, and it has also been implicated in glaucoma pathogenesis. This gene exists in a cluster with four other paralogous genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired ATP- or calcium ionophore ionomycin-induced citrullination of mast cells or of proteins following induction of EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,399 G303E probably damaging Het
Adamts1 A T 16: 85,795,976 Y515N probably damaging Het
Ankef1 T C 2: 136,554,738 V695A probably benign Het
Ankrd63 C A 2: 118,703,353 probably benign Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Atf2 A C 2: 73,863,208 D3E probably damaging Het
Atp5f1 T C 3: 105,943,874 probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 A C 6: 118,392,627 L960W probably damaging Het
Cacna1c A G 6: 118,656,137 V977A probably damaging Het
Cadps2 A G 6: 23,839,122 S6P possibly damaging Het
Capn8 A G 1: 182,613,386 T462A probably benign Het
Cd226 T C 18: 89,207,362 S128P probably benign Het
Cd33 G T 7: 43,529,892 H278N probably benign Het
Cdh1 T C 8: 106,666,182 probably benign Het
Cfap54 T C 10: 93,038,809 probably null Het
Chit1 A G 1: 134,151,144 I397M probably benign Het
Cic C A 7: 25,271,536 Q231K possibly damaging Het
Clca4b A G 3: 144,925,163 V312A probably damaging Het
Cngb1 T A 8: 95,297,085 probably null Het
Cyfip2 T C 11: 46,249,789 I430V probably benign Het
Dnah12 A G 14: 26,781,528 E1613G probably null Het
Dock2 T C 11: 34,294,106 probably null Het
Dync2h1 A T 9: 7,160,171 F646I probably damaging Het
Eef1b2 A T 1: 63,179,487 K144* probably null Het
Erap1 T C 13: 74,669,450 V137A probably benign Het
Fam196a T G 7: 134,918,430 K124Q probably damaging Het
Far1 A T 7: 113,539,271 probably null Het
Fbn2 A T 18: 58,090,658 C807S probably damaging Het
Fgfr1 A G 8: 25,558,215 K209R probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Frem2 A T 3: 53,535,744 V2533D probably damaging Het
Hip1r T C 5: 124,000,731 M839T probably benign Het
Igfbp2 A G 1: 72,852,151 S303G probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itgb3 T G 11: 104,623,413 S27A probably benign Het
Kif21b G A 1: 136,160,313 D1015N probably damaging Het
Krt7 A T 15: 101,423,484 probably null Het
Krtdap T A 7: 30,790,585 F80L probably benign Het
Lcp1 A T 14: 75,200,401 T84S probably benign Het
Lipi G A 16: 75,550,199 T444I probably damaging Het
Lrguk A T 6: 34,071,068 E316V probably damaging Het
Lypd1 G A 1: 125,910,535 probably benign Het
Med12l A T 3: 59,262,310 K1632* probably null Het
Mrgpra9 A T 7: 47,235,835 M28K probably benign Het
Mylk A G 16: 34,953,653 K1291E probably benign Het
Nek4 T A 14: 30,953,923 W72R probably damaging Het
Nudt8 T C 19: 4,001,899 V170A probably damaging Het
Oosp3 T A 19: 11,699,369 Y31N probably benign Het
Pcf11 G T 7: 92,661,879 N300K probably damaging Het
Pcsk5 T C 19: 17,581,144 D633G possibly damaging Het
Phlpp2 T A 8: 109,907,600 W271R probably damaging Het
Pikfyve T C 1: 65,253,353 V1276A probably benign Het
Pkhd1l1 A T 15: 44,479,654 N176Y probably damaging Het
Pop5 T G 5: 115,238,212 V33G possibly damaging Het
Prkag2 A G 5: 24,947,582 F175L possibly damaging Het
Ptpn22 T A 3: 103,874,021 D79E possibly damaging Het
Rab32 T G 10: 10,550,833 D123A probably damaging Het
Rnpc3 T C 3: 113,608,360 K513E possibly damaging Het
Senp1 A T 15: 98,059,944 F358I possibly damaging Het
Sft2d2 A G 1: 165,185,078 L83P probably damaging Het
Slc9c1 G A 16: 45,580,250 R741H probably damaging Het
Smad4 A T 18: 73,649,806 Y352* probably null Het
Tamm41 T A 6: 115,016,095 Q232H probably benign Het
Tbx6 T A 7: 126,782,883 L131Q probably damaging Het
Trappc10 T C 10: 78,209,479 probably benign Het
Trp53bp1 C A 2: 121,204,483 A108S probably benign Het
Unc13b G A 4: 43,091,266 V31M probably damaging Het
Usp24 T C 4: 106,400,980 M1525T possibly damaging Het
Vax2 G A 6: 83,711,270 probably benign Het
Vcan T A 13: 89,690,985 I2147L probably benign Het
Zbtb7a C A 10: 81,144,410 A146E probably benign Het
Zcchc6 T C 13: 59,800,656 Y215C probably damaging Het
Zfp287 A G 11: 62,727,569 L157P probably damaging Het
Other mutations in Padi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Padi2 APN 4 140917637 missense probably benign 0.27
IGL01374:Padi2 APN 4 140933185 missense probably damaging 1.00
IGL01608:Padi2 APN 4 140932230 missense probably damaging 1.00
IGL02085:Padi2 APN 4 140927157 nonsense probably null
IGL02593:Padi2 APN 4 140949842 missense probably damaging 1.00
IGL02668:Padi2 APN 4 140949880 missense probably benign 0.02
IGL03341:Padi2 APN 4 140927113 missense probably benign 0.06
R0116:Padi2 UTSW 4 140926239 missense probably benign 0.00
R2079:Padi2 UTSW 4 140933196 missense probably damaging 1.00
R3022:Padi2 UTSW 4 140937988 missense possibly damaging 0.79
R3079:Padi2 UTSW 4 140949878 missense probably damaging 0.99
R3780:Padi2 UTSW 4 140917737 missense probably benign 0.00
R4250:Padi2 UTSW 4 140906546 missense probably damaging 0.97
R4276:Padi2 UTSW 4 140936548 missense possibly damaging 0.93
R4647:Padi2 UTSW 4 140944446 missense probably damaging 1.00
R5058:Padi2 UTSW 4 140932121 missense probably benign 0.00
R5452:Padi2 UTSW 4 140932071 missense probably benign 0.26
R5471:Padi2 UTSW 4 140933208 missense possibly damaging 0.90
R5489:Padi2 UTSW 4 140944488 missense probably damaging 0.99
R5519:Padi2 UTSW 4 140949222 missense probably damaging 1.00
R5666:Padi2 UTSW 4 140949231 missense possibly damaging 0.76
R5793:Padi2 UTSW 4 140933190 missense probably benign 0.04
R5913:Padi2 UTSW 4 140917641 missense probably benign 0.00
R5929:Padi2 UTSW 4 140944537 critical splice donor site probably null
R5933:Padi2 UTSW 4 140917641 missense probably benign 0.00
R6478:Padi2 UTSW 4 140917637 missense probably benign 0.00
R6809:Padi2 UTSW 4 140946766 splice site probably null
R7075:Padi2 UTSW 4 140933217 missense probably damaging 0.96
R7313:Padi2 UTSW 4 140932768 missense probably damaging 0.99
R7380:Padi2 UTSW 4 140917686 nonsense probably null
R7391:Padi2 UTSW 4 140937955 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGCCTTCCACATTGGCCTTAC -3'
(R):5'- GCAGCTCACTCTAGTCTTGG -3'

Sequencing Primer
(F):5'- TACATCTGCTTGCCCCAGGG -3'
(R):5'- ACTCTAGTCTTGGGCCATCAG -3'
Posted On2014-08-25