Mutagenetix > Incidental Mutations

Incidental Mutation 'R1977:Lgr4'

221795

Institutional Source

Beutler Lab

Gene Symbol

Lgr4

Ensembl Gene

ENSMUSG00000050199

Gene Name

leucine-rich repeat-containing G protein-coupled receptor 4

Synonyms

A930009A08Rik, Gpr48, A330106J01Rik

MMRRC Submission

039990-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1977 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109917647-110014257 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 110011928 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 729 (I729F)

Ref Sequence

ENSEMBL: ENSMUSP00000106666 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046548] [ENSMUST00000111037]

Predicted Effect

probably damaging
Transcript: ENSMUST00000046548
AA Change: I753F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000047325
Gene: ENSMUSG00000050199
AA Change: I753F

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
LRRNT	28	61	6.68e-6	SMART
LRR	55	79	1.49e1	SMART
LRR	80	103	1.99e0	SMART
LRR_TYP	104	127	2.75e-3	SMART
LRR_TYP	128	151	2.79e-4	SMART
LRR	152	175	2.54e1	SMART
LRR	176	199	4.65e-1	SMART
LRR_TYP	200	223	1.04e-3	SMART
LRR	224	246	6.4e0	SMART
LRR_TYP	247	270	5.99e-4	SMART
LRR	272	294	9.77e1	SMART
LRR	318	341	3e1	SMART
LRR	343	363	4.71e1	SMART
LRR	364	387	1.49e1	SMART
LRR_TYP	388	411	1.15e-5	SMART
LRR	412	435	3.98e1	SMART
low complexity region	500	516	N/A	INTRINSIC
Pfam:7tm_1	555	801	2.7e-10	PFAM
low complexity region	824	837	N/A	INTRINSIC
low complexity region	910	924	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111037
AA Change: I729F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106666
Gene: ENSMUSG00000050199
AA Change: I729F

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
LRRNT	28	61	6.68e-6	SMART
LRR	55	79	9.77e1	SMART
LRR_TYP	80	103	2.75e-3	SMART
LRR_TYP	104	127	2.79e-4	SMART
LRR	128	151	2.54e1	SMART
LRR	152	175	4.65e-1	SMART
LRR_TYP	176	199	1.04e-3	SMART
LRR	200	222	6.4e0	SMART
LRR_TYP	223	246	5.99e-4	SMART
LRR	248	270	9.77e1	SMART
LRR	294	317	3e1	SMART
LRR	319	339	4.71e1	SMART
LRR	340	363	1.49e1	SMART
LRR_TYP	364	387	1.15e-5	SMART
LRR	388	411	3.98e1	SMART
low complexity region	476	492	N/A	INTRINSIC
Pfam:7tm_1	531	777	9.3e-17	PFAM
low complexity region	800	813	N/A	INTRINSIC
low complexity region	886	900	N/A	INTRINSIC

Meta Mutation Damage Score

0.5535

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

99% (66/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor that binds R-spondins and activates the Wnt signaling pathway. This Wnt signaling pathway activation is necessary for proper development of many organs of the body. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a knock-out allele show embryonic and perinatal death, open eyelids, and abnormal renal development. One gene trap mutation leads to reduced body weight, sterility, and impaired male reproductive tract development. Another gene trap mutation causes ocular anterior segment anomalies. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsf3	G	T	8: 122,781,533	C256F	probably damaging	Het
Adgra2	T	A	8: 27,115,761	V647D	possibly damaging	Het
AI593442	A	T	9: 52,678,192	S28R	probably damaging	Het
Akr1c21	G	C	13: 4,574,212	G22R	probably damaging	Het
Ampd3	T	C	7: 110,803,162	W458R	probably damaging	Het
Arhgap23	G	T	11: 97,451,447	R185L	possibly damaging	Het
Arhgap45	A	T	10: 80,020,818	I67F	probably damaging	Het
Asah1	A	G	8: 41,343,517		probably null	Het
Atl2	A	G	17: 79,852,590	Y56H	probably damaging	Het
Carf	A	T	1: 60,146,136	I447F	probably damaging	Het
Crmp1	A	G	5: 37,276,283	N162S	probably damaging	Het
Cyp2a5	A	G	7: 26,835,922	E103G	probably benign	Het
Cyp2c40	T	C	19: 39,778,041	D370G	probably damaging	Het
Dhrs2	T	A	14: 55,234,655	M1K	probably null	Het
Dnah17	T	C	11: 118,112,591	E810G	possibly damaging	Het
E2f5	T	A	3: 14,587,356	I84N	probably damaging	Het
Eif2ak4	A	T	2: 118,461,757	K1185*	probably null	Het
Eif4ebp1	T	A	8: 27,275,101	M115K	probably damaging	Het
Evi5	A	T	5: 107,799,139	L505*	probably null	Het
Fbxw25	T	A	9: 109,652,856	Y254F	possibly damaging	Het
Gm7964	T	A	7: 83,757,352	F439Y	possibly damaging	Het
Gps1	A	G	11: 120,785,826	T124A	probably damaging	Het
Hopx	T	C	5: 77,117,616		probably benign	Het
Hoxd3	A	G	2: 74,744,276	S89G	possibly damaging	Het
Hrc	A	T	7: 45,336,214	D263V	probably damaging	Het
Hs6st3	T	C	14: 119,138,476	I21T	probably benign	Het
Izumo4	A	G	10: 80,703,121	Y106C	probably damaging	Het
Lama2	A	T	10: 26,990,800		probably null	Het
Lcorl	A	C	5: 45,775,420	S123R	probably null	Het
Lonp1	T	C	17: 56,615,068	T771A	possibly damaging	Het
Matn3	T	A	12: 8,961,110		probably benign	Het
Mdc1	T	A	17: 35,850,930	S912T	probably benign	Het
Mgam	G	A	6: 40,664,880	V556I	probably benign	Het
Myom2	A	T	8: 15,085,263	I489F	possibly damaging	Het
Nfatc2	G	A	2: 168,504,459	T905I	possibly damaging	Het
Nme6	G	A	9: 109,835,341	R6Q	probably damaging	Het
Nr1h5	A	G	3: 102,947,817	S323P	probably damaging	Het
Nr4a3	C	A	4: 48,056,539	R364S	probably damaging	Het
Obox7	A	T	7: 14,664,398	D79V	probably damaging	Het
Olfr167	G	A	16: 19,514,836	P267S	probably damaging	Het
Olfr374	G	A	8: 72,109,854	G96D	probably benign	Het
Olfr435	T	A	6: 43,201,980	V112D	possibly damaging	Het
Pan2	T	C	10: 128,320,413	V1171A	probably damaging	Het
Parp8	T	A	13: 116,910,913	I208F	probably damaging	Het
Pdgfc	C	T	3: 81,209,245	T302I	probably damaging	Het
Pnpt1	A	G	11: 29,141,256	I337V	probably benign	Het
Polk	T	C	13: 96,489,228	E436G	probably damaging	Het
Pramel7	A	G	2: 87,491,121	V190A	probably benign	Het
Rplp2	T	C	7: 141,448,781		probably benign	Het
Sec23ip	T	A	7: 128,766,273	S670T	probably damaging	Het
Sgk2	A	G	2: 163,004,160	N207S	probably benign	Het
Sh2d2a	C	T	3: 87,851,816	Q242*	probably null	Het
Sh3pxd2b	A	C	11: 32,422,138	N435T	probably damaging	Het
Slc36a4	T	A	9: 15,734,210	V311D	probably damaging	Het
Stx17	G	A	4: 48,181,553	V241M	probably benign	Het
Taok3	A	T	5: 117,265,924	K721N	probably damaging	Het
Tbxas1	A	G	6: 38,948,641		probably benign	Het
Tmem87a	G	A	2: 120,374,504	A377V	probably benign	Het
Topaz1	C	T	9: 122,747,362	T6M	unknown	Het
Tspan8	A	G	10: 115,844,130	I217V	probably benign	Het
Vmn2r125	A	G	4: 156,354,591		probably null	Het
Vmn2r5	C	T	3: 64,504,221	E309K	probably damaging	Het
Wdr59	A	T	8: 111,458,638	C888S	probably benign	Het

Other mutations in Lgr4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02043:Lgr4	APN	2	110011290	missense	probably damaging	1.00
IGL02247:Lgr4	APN	2	110002501	missense	probably benign
IGL02247:Lgr4	APN	2	110008075	splice site	probably benign
IGL02302:Lgr4	APN	2	110002496	missense	probably damaging	0.99
IGL02309:Lgr4	APN	2	110012535	utr 3 prime	probably benign
IGL02511:Lgr4	APN	2	110011272	missense	probably benign	0.06
IGL02604:Lgr4	APN	2	110011313	missense	probably damaging	1.00
IGL02648:Lgr4	APN	2	110012373	missense	probably damaging	1.00
IGL02795:Lgr4	APN	2	110008210	splice site	probably benign
IGL02899:Lgr4	APN	2	109918253	missense	probably damaging	0.99
R0003:Lgr4	UTSW	2	109997665	critical splice donor site	probably null
R0200:Lgr4	UTSW	2	109970690	critical splice acceptor site	probably null
R0314:Lgr4	UTSW	2	109991093	splice site	probably benign
R0482:Lgr4	UTSW	2	110008092	missense	probably damaging	1.00
R0491:Lgr4	UTSW	2	110007281	splice site	probably benign
R0517:Lgr4	UTSW	2	110011320	missense	probably damaging	1.00
R0546:Lgr4	UTSW	2	109999421	missense	probably damaging	0.98
R0658:Lgr4	UTSW	2	110011787	missense	possibly damaging	0.83
R1367:Lgr4	UTSW	2	109991135	missense	probably damaging	0.98
R1864:Lgr4	UTSW	2	110011397	missense	possibly damaging	0.93
R2239:Lgr4	UTSW	2	110012393	missense	probably damaging	1.00
R2380:Lgr4	UTSW	2	110012393	missense	probably damaging	1.00
R2383:Lgr4	UTSW	2	110000615	missense	probably damaging	1.00
R2997:Lgr4	UTSW	2	110003517	missense	probably benign	0.30
R3707:Lgr4	UTSW	2	109970754	missense	probably damaging	0.99
R3803:Lgr4	UTSW	2	110008197	missense	probably benign	0.10
R3804:Lgr4	UTSW	2	110008197	missense	probably benign	0.10
R3843:Lgr4	UTSW	2	109996773	splice site	probably benign
R4030:Lgr4	UTSW	2	109989751	missense	probably benign	0.06
R4513:Lgr4	UTSW	2	110012016	missense	possibly damaging	0.93
R4777:Lgr4	UTSW	2	109996682	missense	probably damaging	0.98
R4912:Lgr4	UTSW	2	110006502	critical splice acceptor site	probably null
R4994:Lgr4	UTSW	2	110011938	missense	probably damaging	0.99
R5106:Lgr4	UTSW	2	109997595	missense	probably damaging	0.97
R5131:Lgr4	UTSW	2	110012333	missense	probably benign
R5152:Lgr4	UTSW	2	110000603	missense	probably damaging	1.00
R5753:Lgr4	UTSW	2	110002512	nonsense	probably null
R5860:Lgr4	UTSW	2	109991151	missense	probably damaging	0.96
R5914:Lgr4	UTSW	2	109918272	missense	possibly damaging	0.78
R6145:Lgr4	UTSW	2	110007243	nonsense	probably null
R6263:Lgr4	UTSW	2	110011898	missense	possibly damaging	0.95
R6400:Lgr4	UTSW	2	109991133	missense	probably damaging	0.98
R6924:Lgr4	UTSW	2	110012439	missense	probably damaging	1.00
R7171:Lgr4	UTSW	2	110000969	missense	probably benign	0.11
R7326:Lgr4	UTSW	2	109996629	nonsense	probably null
R7593:Lgr4	UTSW	2	109999456	missense	probably damaging	1.00
R7659:Lgr4	UTSW	2	109996766	missense	probably damaging	1.00
R7707:Lgr4	UTSW	2	109997591	critical splice acceptor site	probably null
X0053:Lgr4	UTSW	2	110011437	missense	possibly damaging	0.52

Predicted Primers

PCR Primer
(F):5'- GTGCTTGCCATTTCCTACAGG -3'
(R):5'- CTGATCCGTGTTTCCTGGTGAC -3'

Sequencing Primer
(F):5'- TTGCCATTTCCTACAGGAGAGAC -3'
(R):5'- AGGAGCTTCCAGTCGTCTTTAAAC -3'

Posted On

2014-08-25