Incidental Mutation 'R2045:Cadps2'
ID 221802
Institutional Source Beutler Lab
Gene Symbol Cadps2
Ensembl Gene ENSMUSG00000017978
Gene Name Ca2+-dependent activator protein for secretion 2
Synonyms Caps2, A230044C21Rik, cpd2
MMRRC Submission 040052-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2045 (G1)
Quality Score 119
Status Not validated
Chromosome 6
Chromosomal Location 23262772-23839420 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23839121 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 6 (S6P)
Ref Sequence ENSEMBL: ENSMUSP00000125972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115356] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000163871] [ENSMUST00000142913] [ENSMUST00000166458]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000018122
AA Change: S6P
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: S6P

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect unknown
Transcript: ENSMUST00000069074
AA Change: S6P
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: S6P

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115355
SMART Domains Protein: ENSMUSP00000111012
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000115356
AA Change: S6P
SMART Domains Protein: ENSMUSP00000111013
Gene: ENSMUSG00000017978
AA Change: S6P

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
Predicted Effect unknown
Transcript: ENSMUST00000115358
AA Change: S6P
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: S6P

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect unknown
Transcript: ENSMUST00000115361
AA Change: S6P
SMART Domains Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: S6P

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 892 1.9e-49 SMART
Predicted Effect unknown
Transcript: ENSMUST00000163871
AA Change: S6P
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: S6P

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect unknown
Transcript: ENSMUST00000142913
AA Change: S6P
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: S6P

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136279
Predicted Effect possibly damaging
Transcript: ENSMUST00000166458
AA Change: S6P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: S6P

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,220,799 (GRCm39) G303E probably damaging Het
Adamts1 A T 16: 85,592,864 (GRCm39) Y515N probably damaging Het
Ankef1 T C 2: 136,396,658 (GRCm39) V695A probably benign Het
Ankrd63 C A 2: 118,533,834 (GRCm39) probably benign Het
Asah2 A T 19: 32,030,356 (GRCm39) N105K probably benign Het
Atf2 A C 2: 73,693,552 (GRCm39) D3E probably damaging Het
Atp5pb T C 3: 105,851,190 (GRCm39) probably benign Het
Bag4 C T 8: 26,259,516 (GRCm39) A228T probably benign Het
Bms1 A C 6: 118,369,588 (GRCm39) L960W probably damaging Het
Cacna1c A G 6: 118,633,098 (GRCm39) V977A probably damaging Het
Capn8 A G 1: 182,440,951 (GRCm39) T462A probably benign Het
Cd226 T C 18: 89,225,486 (GRCm39) S128P probably benign Het
Cd33 G T 7: 43,179,316 (GRCm39) H278N probably benign Het
Cdh1 T C 8: 107,392,814 (GRCm39) probably benign Het
Cfap54 T C 10: 92,874,671 (GRCm39) probably null Het
Chit1 A G 1: 134,078,882 (GRCm39) I397M probably benign Het
Cic C A 7: 24,970,961 (GRCm39) Q231K possibly damaging Het
Clca4b A G 3: 144,630,924 (GRCm39) V312A probably damaging Het
Cngb1 T A 8: 96,023,713 (GRCm39) probably null Het
Cyfip2 T C 11: 46,140,616 (GRCm39) I430V probably benign Het
Dnah12 A G 14: 26,503,485 (GRCm39) E1613G probably null Het
Dock2 T C 11: 34,244,106 (GRCm39) probably null Het
Dync2h1 A T 9: 7,160,171 (GRCm39) F646I probably damaging Het
Eef1b2 A T 1: 63,218,646 (GRCm39) K144* probably null Het
Erap1 T C 13: 74,817,569 (GRCm39) V137A probably benign Het
Far1 A T 7: 113,138,478 (GRCm39) probably null Het
Fbn2 A T 18: 58,223,730 (GRCm39) C807S probably damaging Het
Fgfr1 A G 8: 26,048,231 (GRCm39) K209R probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,242,596 (GRCm39) probably null Het
Frem2 A T 3: 53,443,165 (GRCm39) V2533D probably damaging Het
Hip1r T C 5: 124,138,794 (GRCm39) M839T probably benign Het
Igfbp2 A G 1: 72,891,310 (GRCm39) S303G probably benign Het
Insyn2a T G 7: 134,520,159 (GRCm39) K124Q probably damaging Het
Itga10 C T 3: 96,559,054 (GRCm39) probably benign Het
Itgb3 T G 11: 104,514,239 (GRCm39) S27A probably benign Het
Kif21b G A 1: 136,088,051 (GRCm39) D1015N probably damaging Het
Krt7 A T 15: 101,321,365 (GRCm39) probably null Het
Krtdap T A 7: 30,490,010 (GRCm39) F80L probably benign Het
Lcp1 A T 14: 75,437,841 (GRCm39) T84S probably benign Het
Lipi G A 16: 75,347,087 (GRCm39) T444I probably damaging Het
Lrguk A T 6: 34,048,003 (GRCm39) E316V probably damaging Het
Lypd1 G A 1: 125,838,272 (GRCm39) probably benign Het
Med12l A T 3: 59,169,731 (GRCm39) K1632* probably null Het
Mrgpra9 A T 7: 46,885,583 (GRCm39) M28K probably benign Het
Mylk A G 16: 34,774,023 (GRCm39) K1291E probably benign Het
Nek4 T A 14: 30,675,880 (GRCm39) W72R probably damaging Het
Nudt8 T C 19: 4,051,899 (GRCm39) V170A probably damaging Het
Oosp3 T A 19: 11,676,733 (GRCm39) Y31N probably benign Het
Padi2 A T 4: 140,665,241 (GRCm39) R449W probably damaging Het
Pcf11 G T 7: 92,311,087 (GRCm39) N300K probably damaging Het
Pcsk5 T C 19: 17,558,508 (GRCm39) D633G possibly damaging Het
Phlpp2 T A 8: 110,634,232 (GRCm39) W271R probably damaging Het
Pikfyve T C 1: 65,292,512 (GRCm39) V1276A probably benign Het
Pkhd1l1 A T 15: 44,343,050 (GRCm39) N176Y probably damaging Het
Pop5 T G 5: 115,376,271 (GRCm39) V33G possibly damaging Het
Prkag2 A G 5: 25,152,580 (GRCm39) F175L possibly damaging Het
Ptpn22 T A 3: 103,781,337 (GRCm39) D79E possibly damaging Het
Rab32 T G 10: 10,426,577 (GRCm39) D123A probably damaging Het
Rnpc3 T C 3: 113,402,009 (GRCm39) K513E possibly damaging Het
Senp1 A T 15: 97,957,825 (GRCm39) F358I possibly damaging Het
Sft2d2 A G 1: 165,012,647 (GRCm39) L83P probably damaging Het
Slc9c1 G A 16: 45,400,613 (GRCm39) R741H probably damaging Het
Smad4 A T 18: 73,782,877 (GRCm39) Y352* probably null Het
Tamm41 T A 6: 114,993,056 (GRCm39) Q232H probably benign Het
Tbx6 T A 7: 126,382,055 (GRCm39) L131Q probably damaging Het
Trappc10 T C 10: 78,045,313 (GRCm39) probably benign Het
Trp53bp1 C A 2: 121,034,964 (GRCm39) A108S probably benign Het
Tut7 T C 13: 59,948,470 (GRCm39) Y215C probably damaging Het
Unc13b G A 4: 43,091,266 (GRCm39) V31M probably damaging Het
Usp24 T C 4: 106,258,177 (GRCm39) M1525T possibly damaging Het
Vax2 G A 6: 83,688,252 (GRCm39) probably benign Het
Vcan T A 13: 89,839,104 (GRCm39) I2147L probably benign Het
Zbtb7a C A 10: 80,980,244 (GRCm39) A146E probably benign Het
Zfp287 A G 11: 62,618,395 (GRCm39) L157P probably damaging Het
Other mutations in Cadps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Cadps2 APN 6 23,496,873 (GRCm39) missense possibly damaging 0.84
IGL01105:Cadps2 APN 6 23,321,699 (GRCm39) splice site probably benign
IGL01317:Cadps2 APN 6 23,314,172 (GRCm39) missense possibly damaging 0.76
IGL01409:Cadps2 APN 6 23,587,440 (GRCm39) missense probably damaging 1.00
IGL01477:Cadps2 APN 6 23,263,672 (GRCm39) missense probably damaging 1.00
IGL01620:Cadps2 APN 6 23,587,461 (GRCm39) missense probably benign 0.19
IGL01674:Cadps2 APN 6 23,355,851 (GRCm39) missense probably damaging 1.00
IGL01675:Cadps2 APN 6 23,382,904 (GRCm39) missense probably damaging 1.00
IGL01895:Cadps2 APN 6 23,427,274 (GRCm39) missense probably damaging 0.98
IGL02095:Cadps2 APN 6 23,427,309 (GRCm39) missense probably benign 0.01
IGL02200:Cadps2 APN 6 23,385,527 (GRCm39) missense probably damaging 1.00
IGL02380:Cadps2 APN 6 23,287,731 (GRCm39) missense probably benign 0.11
IGL02680:Cadps2 APN 6 23,838,895 (GRCm39) missense probably damaging 0.99
IGL02814:Cadps2 APN 6 23,321,706 (GRCm39) missense probably damaging 1.00
IGL02940:Cadps2 APN 6 23,496,808 (GRCm39) missense probably benign 0.08
IGL03061:Cadps2 APN 6 23,287,659 (GRCm39) splice site probably null
IGL03233:Cadps2 APN 6 23,263,600 (GRCm39) missense probably benign 0.10
R0193:Cadps2 UTSW 6 23,599,439 (GRCm39) missense probably benign 0.00
R0389:Cadps2 UTSW 6 23,321,781 (GRCm39) missense possibly damaging 0.88
R0571:Cadps2 UTSW 6 23,583,411 (GRCm39) missense probably damaging 1.00
R0595:Cadps2 UTSW 6 23,321,703 (GRCm39) critical splice donor site probably null
R0620:Cadps2 UTSW 6 23,583,395 (GRCm39) missense probably damaging 1.00
R0723:Cadps2 UTSW 6 23,287,697 (GRCm39) missense probably damaging 0.99
R0831:Cadps2 UTSW 6 23,321,739 (GRCm39) missense possibly damaging 0.88
R0836:Cadps2 UTSW 6 23,328,775 (GRCm39) splice site probably benign
R0942:Cadps2 UTSW 6 23,263,561 (GRCm39) missense probably damaging 1.00
R1099:Cadps2 UTSW 6 23,599,478 (GRCm39) missense probably damaging 1.00
R1120:Cadps2 UTSW 6 23,838,793 (GRCm39) missense probably damaging 1.00
R1216:Cadps2 UTSW 6 23,583,472 (GRCm39) splice site probably benign
R1575:Cadps2 UTSW 6 23,429,217 (GRCm39) missense probably damaging 1.00
R1780:Cadps2 UTSW 6 23,320,931 (GRCm39) critical splice donor site probably null
R1924:Cadps2 UTSW 6 23,688,857 (GRCm39) missense probably damaging 0.99
R1944:Cadps2 UTSW 6 23,599,479 (GRCm39) missense probably damaging 0.99
R1956:Cadps2 UTSW 6 23,287,685 (GRCm39) missense probably damaging 1.00
R1986:Cadps2 UTSW 6 23,323,379 (GRCm39) missense probably damaging 1.00
R2146:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2147:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2148:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2150:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2219:Cadps2 UTSW 6 23,410,831 (GRCm39) missense probably damaging 1.00
R2264:Cadps2 UTSW 6 23,323,339 (GRCm39) missense probably benign 0.15
R2338:Cadps2 UTSW 6 23,838,977 (GRCm39) splice site probably benign
R3861:Cadps2 UTSW 6 23,355,860 (GRCm39) missense probably damaging 1.00
R3898:Cadps2 UTSW 6 23,528,125 (GRCm39) missense probably damaging 1.00
R3982:Cadps2 UTSW 6 23,263,530 (GRCm39) utr 3 prime probably benign
R4213:Cadps2 UTSW 6 23,599,462 (GRCm39) missense probably damaging 1.00
R4384:Cadps2 UTSW 6 23,412,987 (GRCm39) missense probably benign 0.18
R4432:Cadps2 UTSW 6 23,626,737 (GRCm39) missense probably damaging 0.99
R4609:Cadps2 UTSW 6 23,587,578 (GRCm39) missense probably damaging 1.00
R4806:Cadps2 UTSW 6 23,688,859 (GRCm39) missense probably damaging 0.96
R4977:Cadps2 UTSW 6 23,599,478 (GRCm39) missense probably damaging 1.00
R5174:Cadps2 UTSW 6 23,287,742 (GRCm39) missense probably damaging 1.00
R5267:Cadps2 UTSW 6 23,626,667 (GRCm39) missense possibly damaging 0.79
R5389:Cadps2 UTSW 6 23,329,103 (GRCm39) missense probably damaging 1.00
R5737:Cadps2 UTSW 6 23,328,804 (GRCm39) missense probably benign 0.28
R6074:Cadps2 UTSW 6 23,626,670 (GRCm39) missense probably damaging 1.00
R6254:Cadps2 UTSW 6 23,329,162 (GRCm39) critical splice acceptor site probably null
R6323:Cadps2 UTSW 6 23,263,577 (GRCm39) missense probably benign 0.04
R6463:Cadps2 UTSW 6 23,323,333 (GRCm39) nonsense probably null
R6907:Cadps2 UTSW 6 23,599,505 (GRCm39) missense probably damaging 1.00
R6940:Cadps2 UTSW 6 23,302,491 (GRCm39) missense probably damaging 1.00
R6964:Cadps2 UTSW 6 23,583,458 (GRCm39) missense probably damaging 1.00
R7079:Cadps2 UTSW 6 23,323,408 (GRCm39) missense probably damaging 1.00
R7139:Cadps2 UTSW 6 23,410,888 (GRCm39) missense probably damaging 1.00
R7156:Cadps2 UTSW 6 23,688,955 (GRCm39) missense probably benign 0.02
R7184:Cadps2 UTSW 6 23,583,428 (GRCm39) missense probably benign 0.18
R7325:Cadps2 UTSW 6 23,409,934 (GRCm39) missense unknown
R7526:Cadps2 UTSW 6 23,496,850 (GRCm39) missense probably damaging 1.00
R7546:Cadps2 UTSW 6 23,626,607 (GRCm39) missense probably benign 0.15
R7772:Cadps2 UTSW 6 23,390,445 (GRCm39) missense probably benign 0.00
R7870:Cadps2 UTSW 6 23,263,641 (GRCm39) missense probably benign 0.14
R8040:Cadps2 UTSW 6 23,412,942 (GRCm39) splice site probably benign
R8048:Cadps2 UTSW 6 23,838,862 (GRCm39) missense probably benign 0.14
R8082:Cadps2 UTSW 6 23,323,313 (GRCm39) missense probably damaging 1.00
R8100:Cadps2 UTSW 6 23,838,808 (GRCm39) missense probably damaging 1.00
R8115:Cadps2 UTSW 6 23,328,897 (GRCm39) missense probably benign 0.00
R8497:Cadps2 UTSW 6 23,355,918 (GRCm39) missense probably benign 0.27
R8768:Cadps2 UTSW 6 23,382,938 (GRCm39) missense probably damaging 1.00
R8783:Cadps2 UTSW 6 23,302,303 (GRCm39) missense possibly damaging 0.57
R8804:Cadps2 UTSW 6 23,496,805 (GRCm39) missense probably damaging 1.00
R8832:Cadps2 UTSW 6 23,587,536 (GRCm39) missense possibly damaging 0.52
R8848:Cadps2 UTSW 6 23,344,256 (GRCm39) missense probably damaging 1.00
R8854:Cadps2 UTSW 6 23,385,507 (GRCm39) missense probably damaging 1.00
R8896:Cadps2 UTSW 6 23,410,876 (GRCm39) missense probably damaging 1.00
R8910:Cadps2 UTSW 6 23,344,223 (GRCm39) missense probably benign 0.11
R8921:Cadps2 UTSW 6 23,302,300 (GRCm39) missense probably benign 0.00
R9228:Cadps2 UTSW 6 23,688,927 (GRCm39) missense probably benign 0.00
R9297:Cadps2 UTSW 6 23,496,887 (GRCm39) missense probably benign
R9318:Cadps2 UTSW 6 23,496,887 (GRCm39) missense probably benign
R9348:Cadps2 UTSW 6 23,344,262 (GRCm39) missense probably benign 0.20
R9447:Cadps2 UTSW 6 23,323,297 (GRCm39) missense probably damaging 0.96
R9484:Cadps2 UTSW 6 23,626,646 (GRCm39) missense probably benign 0.02
R9492:Cadps2 UTSW 6 23,427,238 (GRCm39) missense probably benign
R9630:Cadps2 UTSW 6 23,587,571 (GRCm39) missense probably benign 0.08
R9729:Cadps2 UTSW 6 23,382,982 (GRCm39) missense probably benign 0.28
Z1176:Cadps2 UTSW 6 23,321,800 (GRCm39) missense probably benign 0.24
Z1177:Cadps2 UTSW 6 23,838,817 (GRCm39) missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23,626,694 (GRCm39) missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23,385,477 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTGAATGGGTACGCGATGCAC -3'
(R):5'- AACTCGACGTGTCCGGAAAG -3'

Sequencing Primer
(F):5'- GTACGCGATGCACCTCAC -3'
(R):5'- AAAGCCCGGGCCACTTTC -3'
Posted On 2014-08-25