Incidental Mutation 'R1977:E2f5'
ID221805
Institutional Source Beutler Lab
Gene Symbol E2f5
Ensembl Gene ENSMUSG00000027552
Gene NameE2F transcription factor 5
SynonymsE2F-5
MMRRC Submission 039990-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.750) question?
Stock #R1977 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location14578641-14606309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14587356 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 84 (I84N)
Ref Sequence ENSEMBL: ENSMUSP00000127877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029069] [ENSMUST00000165922]
Predicted Effect probably damaging
Transcript: ENSMUST00000029069
AA Change: I84N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029069
Gene: ENSMUSG00000027552
AA Change: I84N

DomainStartEndE-ValueType
low complexity region 6 33 N/A INTRINSIC
Pfam:E2F_TDP 40 106 3.3e-28 PFAM
coiled coil region 111 146 N/A INTRINSIC
low complexity region 223 256 N/A INTRINSIC
low complexity region 283 293 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165922
AA Change: I84N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127877
Gene: ENSMUSG00000027552
AA Change: I84N

DomainStartEndE-ValueType
low complexity region 6 33 N/A INTRINSIC
E2F_TDP 40 106 8.76e-31 SMART
Pfam:E2F_CC-MB 123 221 6.9e-35 PFAM
low complexity region 224 257 N/A INTRINSIC
low complexity region 284 294 N/A INTRINSIC
Meta Mutation Damage Score 0.9665 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionarily conserved domains that are present in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein is differentially phosphorylated and is expressed in a wide variety of human tissues. It has higher identity to E2F4 than to other family members. Both this protein and E2F4 interact with tumor suppressor proteins p130 and p107, but not with pRB. Alternative splicing results in multiple variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop non-obstructive hydrocephalus, ruffled coats, ataxic gait, and dehydration after weaning and die prematurely at an average age of 6 weeks. They exhibit dilated ventricles and cerebral cortex atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf3 G T 8: 122,781,533 C256F probably damaging Het
Adgra2 T A 8: 27,115,761 V647D possibly damaging Het
AI593442 A T 9: 52,678,192 S28R probably damaging Het
Akr1c21 G C 13: 4,574,212 G22R probably damaging Het
Ampd3 T C 7: 110,803,162 W458R probably damaging Het
Arhgap23 G T 11: 97,451,447 R185L possibly damaging Het
Arhgap45 A T 10: 80,020,818 I67F probably damaging Het
Asah1 A G 8: 41,343,517 probably null Het
Atl2 A G 17: 79,852,590 Y56H probably damaging Het
Carf A T 1: 60,146,136 I447F probably damaging Het
Crmp1 A G 5: 37,276,283 N162S probably damaging Het
Cyp2a5 A G 7: 26,835,922 E103G probably benign Het
Cyp2c40 T C 19: 39,778,041 D370G probably damaging Het
Dhrs2 T A 14: 55,234,655 M1K probably null Het
Dnah17 T C 11: 118,112,591 E810G possibly damaging Het
Eif2ak4 A T 2: 118,461,757 K1185* probably null Het
Eif4ebp1 T A 8: 27,275,101 M115K probably damaging Het
Evi5 A T 5: 107,799,139 L505* probably null Het
Fbxw25 T A 9: 109,652,856 Y254F possibly damaging Het
Gm7964 T A 7: 83,757,352 F439Y possibly damaging Het
Gps1 A G 11: 120,785,826 T124A probably damaging Het
Hopx T C 5: 77,117,616 probably benign Het
Hoxd3 A G 2: 74,744,276 S89G possibly damaging Het
Hrc A T 7: 45,336,214 D263V probably damaging Het
Hs6st3 T C 14: 119,138,476 I21T probably benign Het
Izumo4 A G 10: 80,703,121 Y106C probably damaging Het
Lama2 A T 10: 26,990,800 probably null Het
Lcorl A C 5: 45,775,420 S123R probably null Het
Lgr4 A T 2: 110,011,928 I729F probably damaging Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Matn3 T A 12: 8,961,110 probably benign Het
Mdc1 T A 17: 35,850,930 S912T probably benign Het
Mgam G A 6: 40,664,880 V556I probably benign Het
Myom2 A T 8: 15,085,263 I489F possibly damaging Het
Nfatc2 G A 2: 168,504,459 T905I possibly damaging Het
Nme6 G A 9: 109,835,341 R6Q probably damaging Het
Nr1h5 A G 3: 102,947,817 S323P probably damaging Het
Nr4a3 C A 4: 48,056,539 R364S probably damaging Het
Obox7 A T 7: 14,664,398 D79V probably damaging Het
Olfr167 G A 16: 19,514,836 P267S probably damaging Het
Olfr374 G A 8: 72,109,854 G96D probably benign Het
Olfr435 T A 6: 43,201,980 V112D possibly damaging Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Parp8 T A 13: 116,910,913 I208F probably damaging Het
Pdgfc C T 3: 81,209,245 T302I probably damaging Het
Pnpt1 A G 11: 29,141,256 I337V probably benign Het
Polk T C 13: 96,489,228 E436G probably damaging Het
Pramel7 A G 2: 87,491,121 V190A probably benign Het
Rplp2 T C 7: 141,448,781 probably benign Het
Sec23ip T A 7: 128,766,273 S670T probably damaging Het
Sgk2 A G 2: 163,004,160 N207S probably benign Het
Sh2d2a C T 3: 87,851,816 Q242* probably null Het
Sh3pxd2b A C 11: 32,422,138 N435T probably damaging Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Stx17 G A 4: 48,181,553 V241M probably benign Het
Taok3 A T 5: 117,265,924 K721N probably damaging Het
Tbxas1 A G 6: 38,948,641 probably benign Het
Tmem87a G A 2: 120,374,504 A377V probably benign Het
Topaz1 C T 9: 122,747,362 T6M unknown Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Vmn2r125 A G 4: 156,354,591 probably null Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Wdr59 A T 8: 111,458,638 C888S probably benign Het
Other mutations in E2f5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:E2f5 APN 3 14587303 splice site probably benign
IGL02388:E2f5 APN 3 14588280 missense probably benign 0.00
IGL02415:E2f5 APN 3 14603897 missense probably benign 0.00
R0401:E2f5 UTSW 3 14579025 critical splice donor site probably null
R2434:E2f5 UTSW 3 14579014 missense probably damaging 1.00
R3029:E2f5 UTSW 3 14603665 missense probably benign 0.37
R4405:E2f5 UTSW 3 14603763 missense probably benign 0.09
R4407:E2f5 UTSW 3 14603763 missense probably benign 0.09
R4780:E2f5 UTSW 3 14587319 missense probably benign 0.01
R6627:E2f5 UTSW 3 14603857 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTCTGGTATTGGCAAAGTCTGG -3'
(R):5'- CTACAAGACAGACAGGCCTGTG -3'

Sequencing Primer
(F):5'- TCTAGCTATTGTTCTGAAGACACGG -3'
(R):5'- GACAGGCCTGTGTGATGAC -3'
Posted On2014-08-25