Incidental Mutation 'R2045:Vax2'
ID221806
Institutional Source Beutler Lab
Gene Symbol Vax2
Ensembl Gene ENSMUSG00000034777
Gene Nameventral anterior homeobox 2
Synonyms
MMRRC Submission 040052-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.750) question?
Stock #R2045 (G1)
Quality Score87
Status Validated
Chromosome6
Chromosomal Location83711264-83738313 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to A at 83711270 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037807]
Predicted Effect probably benign
Transcript: ENSMUST00000037807
SMART Domains Protein: ENSMUSP00000035976
Gene: ENSMUSG00000034777

DomainStartEndE-ValueType
low complexity region 7 32 N/A INTRINSIC
HOX 102 164 3.54e-27 SMART
low complexity region 169 180 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 233 247 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184408
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homeobox protein and is almost exclusively expressed in the ventral portion of the retina during development. In mouse studies, this gene was found to be required for the correct formation of the optic fissure and other aspects of retinal development. [provided by RefSeq, Sep 2008]
PHENOTYPE: Homozygous null mutants for one allele show incomplete closure of optic fissure leading to coloboma, the frequency of which is strongly influenced by genetic background. Homozygous null mutants for 2 different alleles have abnormal projections of ventralretinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,399 G303E probably damaging Het
Adamts1 A T 16: 85,795,976 Y515N probably damaging Het
Ankef1 T C 2: 136,554,738 V695A probably benign Het
Ankrd63 C A 2: 118,703,353 probably benign Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Atf2 A C 2: 73,863,208 D3E probably damaging Het
Atp5f1 T C 3: 105,943,874 probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 A C 6: 118,392,627 L960W probably damaging Het
Cacna1c A G 6: 118,656,137 V977A probably damaging Het
Cadps2 A G 6: 23,839,122 S6P possibly damaging Het
Capn8 A G 1: 182,613,386 T462A probably benign Het
Cd226 T C 18: 89,207,362 S128P probably benign Het
Cd33 G T 7: 43,529,892 H278N probably benign Het
Cdh1 T C 8: 106,666,182 probably benign Het
Cfap54 T C 10: 93,038,809 probably null Het
Chit1 A G 1: 134,151,144 I397M probably benign Het
Cic C A 7: 25,271,536 Q231K possibly damaging Het
Clca4b A G 3: 144,925,163 V312A probably damaging Het
Cngb1 T A 8: 95,297,085 probably null Het
Cyfip2 T C 11: 46,249,789 I430V probably benign Het
Dnah12 A G 14: 26,781,528 E1613G probably null Het
Dock2 T C 11: 34,294,106 probably null Het
Dync2h1 A T 9: 7,160,171 F646I probably damaging Het
Eef1b2 A T 1: 63,179,487 K144* probably null Het
Erap1 T C 13: 74,669,450 V137A probably benign Het
Fam196a T G 7: 134,918,430 K124Q probably damaging Het
Far1 A T 7: 113,539,271 probably null Het
Fbn2 A T 18: 58,090,658 C807S probably damaging Het
Fgfr1 A G 8: 25,558,215 K209R probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Frem2 A T 3: 53,535,744 V2533D probably damaging Het
Hip1r T C 5: 124,000,731 M839T probably benign Het
Igfbp2 A G 1: 72,852,151 S303G probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itgb3 T G 11: 104,623,413 S27A probably benign Het
Kif21b G A 1: 136,160,313 D1015N probably damaging Het
Krt7 A T 15: 101,423,484 probably null Het
Krtdap T A 7: 30,790,585 F80L probably benign Het
Lcp1 A T 14: 75,200,401 T84S probably benign Het
Lipi G A 16: 75,550,199 T444I probably damaging Het
Lrguk A T 6: 34,071,068 E316V probably damaging Het
Lypd1 G A 1: 125,910,535 probably benign Het
Med12l A T 3: 59,262,310 K1632* probably null Het
Mrgpra9 A T 7: 47,235,835 M28K probably benign Het
Mylk A G 16: 34,953,653 K1291E probably benign Het
Nek4 T A 14: 30,953,923 W72R probably damaging Het
Nudt8 T C 19: 4,001,899 V170A probably damaging Het
Oosp3 T A 19: 11,699,369 Y31N probably benign Het
Padi2 A T 4: 140,937,930 R449W probably damaging Het
Pcf11 G T 7: 92,661,879 N300K probably damaging Het
Pcsk5 T C 19: 17,581,144 D633G possibly damaging Het
Phlpp2 T A 8: 109,907,600 W271R probably damaging Het
Pikfyve T C 1: 65,253,353 V1276A probably benign Het
Pkhd1l1 A T 15: 44,479,654 N176Y probably damaging Het
Pop5 T G 5: 115,238,212 V33G possibly damaging Het
Prkag2 A G 5: 24,947,582 F175L possibly damaging Het
Ptpn22 T A 3: 103,874,021 D79E possibly damaging Het
Rab32 T G 10: 10,550,833 D123A probably damaging Het
Rnpc3 T C 3: 113,608,360 K513E possibly damaging Het
Senp1 A T 15: 98,059,944 F358I possibly damaging Het
Sft2d2 A G 1: 165,185,078 L83P probably damaging Het
Slc9c1 G A 16: 45,580,250 R741H probably damaging Het
Smad4 A T 18: 73,649,806 Y352* probably null Het
Tamm41 T A 6: 115,016,095 Q232H probably benign Het
Tbx6 T A 7: 126,782,883 L131Q probably damaging Het
Trappc10 T C 10: 78,209,479 probably benign Het
Trp53bp1 C A 2: 121,204,483 A108S probably benign Het
Unc13b G A 4: 43,091,266 V31M probably damaging Het
Usp24 T C 4: 106,400,980 M1525T possibly damaging Het
Vcan T A 13: 89,690,985 I2147L probably benign Het
Zbtb7a C A 10: 81,144,410 A146E probably benign Het
Zcchc6 T C 13: 59,800,656 Y215C probably damaging Het
Zfp287 A G 11: 62,727,569 L157P probably damaging Het
Other mutations in Vax2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Vax2 APN 6 83711537 missense possibly damaging 0.70
IGL02161:Vax2 APN 6 83737903 missense probably damaging 1.00
IGL02584:Vax2 APN 6 83711513 missense probably benign
R0316:Vax2 UTSW 6 83711444 missense possibly damaging 0.79
R0456:Vax2 UTSW 6 83711406 missense probably benign 0.00
R1006:Vax2 UTSW 6 83737777 missense probably damaging 1.00
R2217:Vax2 UTSW 6 83737889 missense probably damaging 0.98
R2324:Vax2 UTSW 6 83711325 missense possibly damaging 0.53
R3979:Vax2 UTSW 6 83737547 missense probably damaging 0.98
R4755:Vax2 UTSW 6 83711397 missense probably damaging 0.99
R7203:Vax2 UTSW 6 83737900 missense probably damaging 0.99
R7242:Vax2 UTSW 6 83711316 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TTGCCAGGCTCTAAACACCG -3'
(R):5'- CTTACCTCGTACCAGGATGC -3'

Sequencing Primer
(F):5'- GAGGCGCGAAGACACCATC -3'
(R):5'- AGTGGTCTGTCTCACCGAG -3'
Posted On2014-08-25