Incidental Mutation 'R2045:Cd33'
ID 221818
Institutional Source Beutler Lab
Gene Symbol Cd33
Ensembl Gene ENSMUSG00000004609
Gene Name CD33 molecule
Synonyms Siglec-3, gp67
MMRRC Submission 040052-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2045 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 43176823-43186679 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 43179316 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 278 (H278N)
Ref Sequence ENSEMBL: ENSMUSP00000146225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004728] [ENSMUST00000039861] [ENSMUST00000205503]
AlphaFold Q63994
Predicted Effect probably benign
Transcript: ENSMUST00000004728
AA Change: H278N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000004728
Gene: ENSMUSG00000004609
AA Change: H278N

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 26 139 2.58e-6 SMART
IG_like 148 232 2.66e1 SMART
transmembrane domain 242 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039861
AA Change: H278N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000045458
Gene: ENSMUSG00000004609
AA Change: H278N

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 26 139 2.58e-6 SMART
IG_like 148 232 2.66e1 SMART
transmembrane domain 242 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205503
AA Change: H278N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205687
Predicted Effect probably benign
Transcript: ENSMUST00000206371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206977
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (74/74)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene show slight reductions in mean erythrocyte count and hematocrit and increased concentration of blood aspartate aminotransaminase. There is also a hyporesponsiveness to induced peritonitis and a weaker IL-6 response to LPS-induced systemic inflammation. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,220,799 (GRCm39) G303E probably damaging Het
Adamts1 A T 16: 85,592,864 (GRCm39) Y515N probably damaging Het
Ankef1 T C 2: 136,396,658 (GRCm39) V695A probably benign Het
Ankrd63 C A 2: 118,533,834 (GRCm39) probably benign Het
Asah2 A T 19: 32,030,356 (GRCm39) N105K probably benign Het
Atf2 A C 2: 73,693,552 (GRCm39) D3E probably damaging Het
Atp5pb T C 3: 105,851,190 (GRCm39) probably benign Het
Bag4 C T 8: 26,259,516 (GRCm39) A228T probably benign Het
Bms1 A C 6: 118,369,588 (GRCm39) L960W probably damaging Het
Cacna1c A G 6: 118,633,098 (GRCm39) V977A probably damaging Het
Cadps2 A G 6: 23,839,121 (GRCm39) S6P possibly damaging Het
Capn8 A G 1: 182,440,951 (GRCm39) T462A probably benign Het
Cd226 T C 18: 89,225,486 (GRCm39) S128P probably benign Het
Cdh1 T C 8: 107,392,814 (GRCm39) probably benign Het
Cfap54 T C 10: 92,874,671 (GRCm39) probably null Het
Chit1 A G 1: 134,078,882 (GRCm39) I397M probably benign Het
Cic C A 7: 24,970,961 (GRCm39) Q231K possibly damaging Het
Clca4b A G 3: 144,630,924 (GRCm39) V312A probably damaging Het
Cngb1 T A 8: 96,023,713 (GRCm39) probably null Het
Cyfip2 T C 11: 46,140,616 (GRCm39) I430V probably benign Het
Dnah12 A G 14: 26,503,485 (GRCm39) E1613G probably null Het
Dock2 T C 11: 34,244,106 (GRCm39) probably null Het
Dync2h1 A T 9: 7,160,171 (GRCm39) F646I probably damaging Het
Eef1b2 A T 1: 63,218,646 (GRCm39) K144* probably null Het
Erap1 T C 13: 74,817,569 (GRCm39) V137A probably benign Het
Far1 A T 7: 113,138,478 (GRCm39) probably null Het
Fbn2 A T 18: 58,223,730 (GRCm39) C807S probably damaging Het
Fgfr1 A G 8: 26,048,231 (GRCm39) K209R probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,242,596 (GRCm39) probably null Het
Frem2 A T 3: 53,443,165 (GRCm39) V2533D probably damaging Het
Hip1r T C 5: 124,138,794 (GRCm39) M839T probably benign Het
Igfbp2 A G 1: 72,891,310 (GRCm39) S303G probably benign Het
Insyn2a T G 7: 134,520,159 (GRCm39) K124Q probably damaging Het
Itga10 C T 3: 96,559,054 (GRCm39) probably benign Het
Itgb3 T G 11: 104,514,239 (GRCm39) S27A probably benign Het
Kif21b G A 1: 136,088,051 (GRCm39) D1015N probably damaging Het
Krt7 A T 15: 101,321,365 (GRCm39) probably null Het
Krtdap T A 7: 30,490,010 (GRCm39) F80L probably benign Het
Lcp1 A T 14: 75,437,841 (GRCm39) T84S probably benign Het
Lipi G A 16: 75,347,087 (GRCm39) T444I probably damaging Het
Lrguk A T 6: 34,048,003 (GRCm39) E316V probably damaging Het
Lypd1 G A 1: 125,838,272 (GRCm39) probably benign Het
Med12l A T 3: 59,169,731 (GRCm39) K1632* probably null Het
Mrgpra9 A T 7: 46,885,583 (GRCm39) M28K probably benign Het
Mylk A G 16: 34,774,023 (GRCm39) K1291E probably benign Het
Nek4 T A 14: 30,675,880 (GRCm39) W72R probably damaging Het
Nudt8 T C 19: 4,051,899 (GRCm39) V170A probably damaging Het
Oosp3 T A 19: 11,676,733 (GRCm39) Y31N probably benign Het
Padi2 A T 4: 140,665,241 (GRCm39) R449W probably damaging Het
Pcf11 G T 7: 92,311,087 (GRCm39) N300K probably damaging Het
Pcsk5 T C 19: 17,558,508 (GRCm39) D633G possibly damaging Het
Phlpp2 T A 8: 110,634,232 (GRCm39) W271R probably damaging Het
Pikfyve T C 1: 65,292,512 (GRCm39) V1276A probably benign Het
Pkhd1l1 A T 15: 44,343,050 (GRCm39) N176Y probably damaging Het
Pop5 T G 5: 115,376,271 (GRCm39) V33G possibly damaging Het
Prkag2 A G 5: 25,152,580 (GRCm39) F175L possibly damaging Het
Ptpn22 T A 3: 103,781,337 (GRCm39) D79E possibly damaging Het
Rab32 T G 10: 10,426,577 (GRCm39) D123A probably damaging Het
Rnpc3 T C 3: 113,402,009 (GRCm39) K513E possibly damaging Het
Senp1 A T 15: 97,957,825 (GRCm39) F358I possibly damaging Het
Sft2d2 A G 1: 165,012,647 (GRCm39) L83P probably damaging Het
Slc9c1 G A 16: 45,400,613 (GRCm39) R741H probably damaging Het
Smad4 A T 18: 73,782,877 (GRCm39) Y352* probably null Het
Tamm41 T A 6: 114,993,056 (GRCm39) Q232H probably benign Het
Tbx6 T A 7: 126,382,055 (GRCm39) L131Q probably damaging Het
Trappc10 T C 10: 78,045,313 (GRCm39) probably benign Het
Trp53bp1 C A 2: 121,034,964 (GRCm39) A108S probably benign Het
Tut7 T C 13: 59,948,470 (GRCm39) Y215C probably damaging Het
Unc13b G A 4: 43,091,266 (GRCm39) V31M probably damaging Het
Usp24 T C 4: 106,258,177 (GRCm39) M1525T possibly damaging Het
Vax2 G A 6: 83,688,252 (GRCm39) probably benign Het
Vcan T A 13: 89,839,104 (GRCm39) I2147L probably benign Het
Zbtb7a C A 10: 80,980,244 (GRCm39) A146E probably benign Het
Zfp287 A G 11: 62,618,395 (GRCm39) L157P probably damaging Het
Other mutations in Cd33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Cd33 APN 7 43,178,982 (GRCm39) intron probably benign
IGL01025:Cd33 APN 7 43,182,329 (GRCm39) missense probably damaging 1.00
IGL01593:Cd33 APN 7 43,179,705 (GRCm39) missense possibly damaging 0.91
IGL02080:Cd33 APN 7 43,178,274 (GRCm39) utr 3 prime probably benign
IGL02519:Cd33 APN 7 43,178,153 (GRCm39) utr 3 prime probably benign
IGL02626:Cd33 APN 7 43,179,736 (GRCm39) splice site probably benign
1mM(1):Cd33 UTSW 7 43,178,217 (GRCm39) utr 3 prime probably benign
R0751:Cd33 UTSW 7 43,181,545 (GRCm39) missense probably damaging 1.00
R1513:Cd33 UTSW 7 43,181,618 (GRCm39) missense probably damaging 1.00
R1542:Cd33 UTSW 7 43,181,530 (GRCm39) missense probably damaging 1.00
R1752:Cd33 UTSW 7 43,181,722 (GRCm39) missense probably benign 0.24
R1928:Cd33 UTSW 7 43,179,303 (GRCm39) missense probably benign 0.41
R2127:Cd33 UTSW 7 43,179,699 (GRCm39) missense possibly damaging 0.72
R3433:Cd33 UTSW 7 43,179,331 (GRCm39) missense probably benign 0.00
R4760:Cd33 UTSW 7 43,178,919 (GRCm39) missense probably benign
R4810:Cd33 UTSW 7 43,182,134 (GRCm39) missense probably damaging 0.99
R5387:Cd33 UTSW 7 43,181,477 (GRCm39) nonsense probably null
R5611:Cd33 UTSW 7 43,181,542 (GRCm39) missense probably damaging 0.97
R5796:Cd33 UTSW 7 43,182,480 (GRCm39) critical splice donor site probably null
R8021:Cd33 UTSW 7 43,178,262 (GRCm39) missense unknown
R8193:Cd33 UTSW 7 43,181,696 (GRCm39) missense possibly damaging 0.96
R8993:Cd33 UTSW 7 43,182,871 (GRCm39) unclassified probably benign
R9495:Cd33 UTSW 7 43,182,150 (GRCm39) missense probably benign 0.09
R9514:Cd33 UTSW 7 43,182,150 (GRCm39) missense probably benign 0.09
R9590:Cd33 UTSW 7 43,179,637 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGAGTGGCTACGTGATGTTTC -3'
(R):5'- GCTCTGGTGCATGTAGTGAC -3'

Sequencing Primer
(F):5'- ACGTGATGTTTCATGGAGGGAG -3'
(R):5'- TGACCGATTCACTTCAACAATGAGG -3'
Posted On 2014-08-25