Incidental Mutation 'R2045:Far1'
ID221825
Institutional Source Beutler Lab
Gene Symbol Far1
Ensembl Gene ENSMUSG00000030759
Gene Namefatty acyl CoA reductase 1
SynonymsMlstd2, 3732409C05Rik, 2600011M19Rik, 2900034E22Rik
MMRRC Submission 040052-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.787) question?
Stock #R2045 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location113513834-113571511 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 113539271 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033018] [ENSMUST00000033018] [ENSMUST00000067929] [ENSMUST00000067929] [ENSMUST00000122890] [ENSMUST00000122890] [ENSMUST00000129087] [ENSMUST00000129087] [ENSMUST00000136158] [ENSMUST00000164745] [ENSMUST00000164745]
Predicted Effect probably null
Transcript: ENSMUST00000033018
SMART Domains Protein: ENSMUSP00000033018
Gene: ENSMUSG00000030759

DomainStartEndE-ValueType
Pfam:Epimerase 13 177 1e-8 PFAM
Pfam:NAD_binding_4 15 285 3.2e-80 PFAM
Pfam:Sterile 356 448 3.1e-34 PFAM
transmembrane domain 466 483 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000033018
SMART Domains Protein: ENSMUSP00000033018
Gene: ENSMUSG00000030759

DomainStartEndE-ValueType
Pfam:Epimerase 13 177 1e-8 PFAM
Pfam:NAD_binding_4 15 285 3.2e-80 PFAM
Pfam:Sterile 356 448 3.1e-34 PFAM
transmembrane domain 466 483 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000067929
SMART Domains Protein: ENSMUSP00000064334
Gene: ENSMUSG00000030759

DomainStartEndE-ValueType
Pfam:Epimerase 13 177 1e-8 PFAM
Pfam:NAD_binding_4 15 285 3.2e-80 PFAM
Pfam:Sterile 356 448 5.4e-36 PFAM
transmembrane domain 466 483 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000067929
SMART Domains Protein: ENSMUSP00000064334
Gene: ENSMUSG00000030759

DomainStartEndE-ValueType
Pfam:Epimerase 13 177 1e-8 PFAM
Pfam:NAD_binding_4 15 285 3.2e-80 PFAM
Pfam:Sterile 356 448 5.4e-36 PFAM
transmembrane domain 466 483 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000122890
Predicted Effect probably null
Transcript: ENSMUST00000122890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123845
Predicted Effect probably null
Transcript: ENSMUST00000129087
SMART Domains Protein: ENSMUSP00000117131
Gene: ENSMUSG00000030759

DomainStartEndE-ValueType
Pfam:Polysacc_synt_2 13 159 1.5e-7 PFAM
Pfam:Epimerase 13 174 8.5e-10 PFAM
Pfam:NAD_binding_4 15 180 9.7e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000129087
SMART Domains Protein: ENSMUSP00000117131
Gene: ENSMUSG00000030759

DomainStartEndE-ValueType
Pfam:Polysacc_synt_2 13 159 1.5e-7 PFAM
Pfam:Epimerase 13 174 8.5e-10 PFAM
Pfam:NAD_binding_4 15 180 9.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136158
SMART Domains Protein: ENSMUSP00000122643
Gene: ENSMUSG00000030759

DomainStartEndE-ValueType
Pfam:Polysacc_synt_2 13 159 2.3e-7 PFAM
Pfam:Epimerase 13 174 1.3e-9 PFAM
Pfam:NAD_binding_4 15 207 7.6e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156875
Predicted Effect probably null
Transcript: ENSMUST00000164745
SMART Domains Protein: ENSMUSP00000128695
Gene: ENSMUSG00000030759

DomainStartEndE-ValueType
Pfam:Epimerase 13 241 1.5e-10 PFAM
Pfam:NAD_binding_4 15 285 9.9e-78 PFAM
Pfam:Sterile 355 448 5.8e-26 PFAM
transmembrane domain 466 483 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164745
SMART Domains Protein: ENSMUSP00000128695
Gene: ENSMUSG00000030759

DomainStartEndE-ValueType
Pfam:Epimerase 13 241 1.5e-10 PFAM
Pfam:NAD_binding_4 15 285 9.9e-78 PFAM
Pfam:Sterile 355 448 5.8e-26 PFAM
transmembrane domain 466 483 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is required for the reduction of fatty acids to fatty alcohols, a process that is required for the synthesis of monoesters and ether lipids. NADPH is required as a cofactor in this reaction, and 16-18 carbon saturated and unsaturated fatty acids are the preferred substrate. This is a peroxisomal membrane protein, and studies suggest that the N-terminus contains a large catalytic domain located on the outside of the peroxisome, while the C-terminus is exposed to the matrix of the peroxisome. Studies indicate that the regulation of this protein is dependent on plasmalogen levels. Mutations in this gene have been associated with individuals affected by severe intellectual disability, early-onset epilepsy, microcephaly, congenital cataracts, growth retardation, and spasticity (PMID: 25439727). A pseudogene of this gene is located on chromosome 13. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,399 G303E probably damaging Het
Adamts1 A T 16: 85,795,976 Y515N probably damaging Het
Ankef1 T C 2: 136,554,738 V695A probably benign Het
Ankrd63 C A 2: 118,703,353 probably benign Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Atf2 A C 2: 73,863,208 D3E probably damaging Het
Atp5f1 T C 3: 105,943,874 probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 A C 6: 118,392,627 L960W probably damaging Het
Cacna1c A G 6: 118,656,137 V977A probably damaging Het
Cadps2 A G 6: 23,839,122 S6P possibly damaging Het
Capn8 A G 1: 182,613,386 T462A probably benign Het
Cd226 T C 18: 89,207,362 S128P probably benign Het
Cd33 G T 7: 43,529,892 H278N probably benign Het
Cdh1 T C 8: 106,666,182 probably benign Het
Cfap54 T C 10: 93,038,809 probably null Het
Chit1 A G 1: 134,151,144 I397M probably benign Het
Cic C A 7: 25,271,536 Q231K possibly damaging Het
Clca4b A G 3: 144,925,163 V312A probably damaging Het
Cngb1 T A 8: 95,297,085 probably null Het
Cyfip2 T C 11: 46,249,789 I430V probably benign Het
Dnah12 A G 14: 26,781,528 E1613G probably null Het
Dock2 T C 11: 34,294,106 probably null Het
Dync2h1 A T 9: 7,160,171 F646I probably damaging Het
Eef1b2 A T 1: 63,179,487 K144* probably null Het
Erap1 T C 13: 74,669,450 V137A probably benign Het
Fam196a T G 7: 134,918,430 K124Q probably damaging Het
Fbn2 A T 18: 58,090,658 C807S probably damaging Het
Fgfr1 A G 8: 25,558,215 K209R probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Frem2 A T 3: 53,535,744 V2533D probably damaging Het
Hip1r T C 5: 124,000,731 M839T probably benign Het
Igfbp2 A G 1: 72,852,151 S303G probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itgb3 T G 11: 104,623,413 S27A probably benign Het
Kif21b G A 1: 136,160,313 D1015N probably damaging Het
Krt7 A T 15: 101,423,484 probably null Het
Krtdap T A 7: 30,790,585 F80L probably benign Het
Lcp1 A T 14: 75,200,401 T84S probably benign Het
Lipi G A 16: 75,550,199 T444I probably damaging Het
Lrguk A T 6: 34,071,068 E316V probably damaging Het
Lypd1 G A 1: 125,910,535 probably benign Het
Med12l A T 3: 59,262,310 K1632* probably null Het
Mrgpra9 A T 7: 47,235,835 M28K probably benign Het
Mylk A G 16: 34,953,653 K1291E probably benign Het
Nek4 T A 14: 30,953,923 W72R probably damaging Het
Nudt8 T C 19: 4,001,899 V170A probably damaging Het
Oosp3 T A 19: 11,699,369 Y31N probably benign Het
Padi2 A T 4: 140,937,930 R449W probably damaging Het
Pcf11 G T 7: 92,661,879 N300K probably damaging Het
Pcsk5 T C 19: 17,581,144 D633G possibly damaging Het
Phlpp2 T A 8: 109,907,600 W271R probably damaging Het
Pikfyve T C 1: 65,253,353 V1276A probably benign Het
Pkhd1l1 A T 15: 44,479,654 N176Y probably damaging Het
Pop5 T G 5: 115,238,212 V33G possibly damaging Het
Prkag2 A G 5: 24,947,582 F175L possibly damaging Het
Ptpn22 T A 3: 103,874,021 D79E possibly damaging Het
Rab32 T G 10: 10,550,833 D123A probably damaging Het
Rnpc3 T C 3: 113,608,360 K513E possibly damaging Het
Senp1 A T 15: 98,059,944 F358I possibly damaging Het
Sft2d2 A G 1: 165,185,078 L83P probably damaging Het
Slc9c1 G A 16: 45,580,250 R741H probably damaging Het
Smad4 A T 18: 73,649,806 Y352* probably null Het
Tamm41 T A 6: 115,016,095 Q232H probably benign Het
Tbx6 T A 7: 126,782,883 L131Q probably damaging Het
Trappc10 T C 10: 78,209,479 probably benign Het
Trp53bp1 C A 2: 121,204,483 A108S probably benign Het
Unc13b G A 4: 43,091,266 V31M probably damaging Het
Usp24 T C 4: 106,400,980 M1525T possibly damaging Het
Vax2 G A 6: 83,711,270 probably benign Het
Vcan T A 13: 89,690,985 I2147L probably benign Het
Zbtb7a C A 10: 81,144,410 A146E probably benign Het
Zcchc6 T C 13: 59,800,656 Y215C probably damaging Het
Zfp287 A G 11: 62,727,569 L157P probably damaging Het
Other mutations in Far1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Far1 APN 7 113540689 missense probably benign 0.07
IGL02597:Far1 APN 7 113551256 missense probably benign 0.31
IGL02937:Far1 APN 7 113540648 missense probably damaging 0.98
R0499:Far1 UTSW 7 113554296 intron probably benign
R2140:Far1 UTSW 7 113566460 missense possibly damaging 0.89
R2852:Far1 UTSW 7 113553737 missense possibly damaging 0.95
R2853:Far1 UTSW 7 113553737 missense possibly damaging 0.95
R4423:Far1 UTSW 7 113540598 missense probably damaging 1.00
R4426:Far1 UTSW 7 113550001 missense probably benign 0.08
R4801:Far1 UTSW 7 113539453 missense possibly damaging 0.77
R4802:Far1 UTSW 7 113539453 missense possibly damaging 0.77
R4898:Far1 UTSW 7 113568225 missense probably damaging 1.00
R5762:Far1 UTSW 7 113568189 missense probably damaging 0.98
R6151:Far1 UTSW 7 113561396 missense possibly damaging 0.60
R6165:Far1 UTSW 7 113554218 missense probably benign
R6278:Far1 UTSW 7 113568137 missense probably benign 0.00
R7269:Far1 UTSW 7 113561447 missense probably benign 0.00
R7356:Far1 UTSW 7 113568142 missense possibly damaging 0.94
R7853:Far1 UTSW 7 113554148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCCAGGAAAGAGCTAGCTC -3'
(R):5'- AGCTCCCAAACTTACCTTGC -3'

Sequencing Primer
(F):5'- CTTGAGGGAGCTGCAATCCATTC -3'
(R):5'- CCAAACTTACCTTGCTACTGAGG -3'
Posted On2014-08-25