Incidental Mutation 'R1977:Hopx'
ID 221827
Institutional Source Beutler Lab
Gene Symbol Hopx
Ensembl Gene ENSMUSG00000059325
Gene Name HOP homeobox
Synonyms 1110018K11Rik, Hop, Ob1, Toto, Cameo, 2300002F06Rik, 1200015P04Rik, Hod
MMRRC Submission 039990-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.450) question?
Stock # R1977 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 77234835-77262968 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 77265463 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081964]
AlphaFold Q8R1H0
PDB Structure Solution structure of mouse homeodomain-only protein HOP [SOLUTION NMR]
Solution structure of the homeodomain-only protein HOP [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000081964
SMART Domains Protein: ENSMUSP00000080630
Gene: ENSMUSG00000059325

DomainStartEndE-ValueType
HOX 3 65 2.48e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156195
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a homeodomain protein that lacks certain conserved residues required for DNA binding. It was reported that choriocarcinoma cell lines and tissues failed to express this gene, which suggested the possible involvement of this gene in malignant conversion of placental trophoblasts. Studies in mice suggest that this protein may interact with serum response factor (SRF) and modulate SRF-dependent cardiac-specific gene expression and cardiac development. Multiple alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous inactivation of this gene causes partial embryonic lethality due to severe developmental cardiac anomalies involving the myocardium, and leads to conduction defects in surviving adults. Mice homozygous for one null allele also exhibit impairedlung maturation leading to neonatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf3 G T 8: 123,508,272 (GRCm39) C256F probably damaging Het
Adgra2 T A 8: 27,605,789 (GRCm39) V647D possibly damaging Het
AI593442 A T 9: 52,589,492 (GRCm39) S28R probably damaging Het
Akr1c21 G C 13: 4,624,211 (GRCm39) G22R probably damaging Het
Ampd3 T C 7: 110,402,369 (GRCm39) W458R probably damaging Het
Arhgap23 G T 11: 97,342,273 (GRCm39) R185L possibly damaging Het
Arhgap45 A T 10: 79,856,652 (GRCm39) I67F probably damaging Het
Asah1 A G 8: 41,796,554 (GRCm39) probably null Het
Atl2 A G 17: 80,160,019 (GRCm39) Y56H probably damaging Het
Carf A T 1: 60,185,295 (GRCm39) I447F probably damaging Het
Crmp1 A G 5: 37,433,627 (GRCm39) N162S probably damaging Het
Cyp2a5 A G 7: 26,535,347 (GRCm39) E103G probably benign Het
Cyp2c40 T C 19: 39,766,485 (GRCm39) D370G probably damaging Het
Dhrs2 T A 14: 55,472,112 (GRCm39) M1K probably null Het
Dnah17 T C 11: 118,003,417 (GRCm39) E810G possibly damaging Het
E2f5 T A 3: 14,652,416 (GRCm39) I84N probably damaging Het
Eif2ak4 A T 2: 118,292,238 (GRCm39) K1185* probably null Het
Eif4ebp1 T A 8: 27,765,129 (GRCm39) M115K probably damaging Het
Evi5 A T 5: 107,947,005 (GRCm39) L505* probably null Het
Fbxw25 T A 9: 109,481,924 (GRCm39) Y254F possibly damaging Het
Gm7964 T A 7: 83,406,560 (GRCm39) F439Y possibly damaging Het
Gps1 A G 11: 120,676,652 (GRCm39) T124A probably damaging Het
Hoxd3 A G 2: 74,574,620 (GRCm39) S89G possibly damaging Het
Hrc A T 7: 44,985,638 (GRCm39) D263V probably damaging Het
Hs6st3 T C 14: 119,375,888 (GRCm39) I21T probably benign Het
Izumo4 A G 10: 80,538,955 (GRCm39) Y106C probably damaging Het
Lama2 A T 10: 26,866,796 (GRCm39) probably null Het
Lcorl A C 5: 45,932,762 (GRCm39) S123R probably null Het
Lgr4 A T 2: 109,842,273 (GRCm39) I729F probably damaging Het
Lonp1 T C 17: 56,922,068 (GRCm39) T771A possibly damaging Het
Matn3 T A 12: 9,011,110 (GRCm39) probably benign Het
Mdc1 T A 17: 36,161,822 (GRCm39) S912T probably benign Het
Mgam G A 6: 40,641,814 (GRCm39) V556I probably benign Het
Myom2 A T 8: 15,135,263 (GRCm39) I489F possibly damaging Het
Nfatc2 G A 2: 168,346,379 (GRCm39) T905I possibly damaging Het
Nme6 G A 9: 109,664,409 (GRCm39) R6Q probably damaging Het
Nr1h5 A G 3: 102,855,133 (GRCm39) S323P probably damaging Het
Nr4a3 C A 4: 48,056,539 (GRCm39) R364S probably damaging Het
Obox7 A T 7: 14,398,323 (GRCm39) D79V probably damaging Het
Or1ab2 G A 8: 72,863,698 (GRCm39) G96D probably benign Het
Or2a51 T A 6: 43,178,914 (GRCm39) V112D possibly damaging Het
Or2l5 G A 16: 19,333,586 (GRCm39) P267S probably damaging Het
Pan2 T C 10: 128,156,282 (GRCm39) V1171A probably damaging Het
Parp8 T A 13: 117,047,449 (GRCm39) I208F probably damaging Het
Pdgfc C T 3: 81,116,552 (GRCm39) T302I probably damaging Het
Pnpt1 A G 11: 29,091,256 (GRCm39) I337V probably benign Het
Polk T C 13: 96,625,736 (GRCm39) E436G probably damaging Het
Pramel7 A G 2: 87,321,465 (GRCm39) V190A probably benign Het
Rplp2 T C 7: 141,028,694 (GRCm39) probably benign Het
Sec23ip T A 7: 128,367,997 (GRCm39) S670T probably damaging Het
Sgk2 A G 2: 162,846,080 (GRCm39) N207S probably benign Het
Sh2d2a C T 3: 87,759,123 (GRCm39) Q242* probably null Het
Sh3pxd2b A C 11: 32,372,138 (GRCm39) N435T probably damaging Het
Slc36a4 T A 9: 15,645,506 (GRCm39) V311D probably damaging Het
Stx17 G A 4: 48,181,553 (GRCm39) V241M probably benign Het
Taok3 A T 5: 117,403,989 (GRCm39) K721N probably damaging Het
Tbxas1 A G 6: 38,925,575 (GRCm39) probably benign Het
Tmem87a G A 2: 120,204,985 (GRCm39) A377V probably benign Het
Topaz1 C T 9: 122,576,427 (GRCm39) T6M unknown Het
Tspan8 A G 10: 115,680,035 (GRCm39) I217V probably benign Het
Vmn2r125 A G 4: 156,707,162 (GRCm39) probably null Het
Vmn2r5 C T 3: 64,411,642 (GRCm39) E309K probably damaging Het
Wdr59 A T 8: 112,185,270 (GRCm39) C888S probably benign Het
Other mutations in Hopx
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5049:Hopx UTSW 5 77,242,899 (GRCm39) utr 5 prime probably benign
Predicted Primers PCR Primer
(F):5'- GCACATTTGGATCTAGGACTTTGC -3'
(R):5'- ATACTGACCATTTCCCGGGTG -3'

Sequencing Primer
(F):5'- ACTTTGCATGAACTGGGCC -3'
(R):5'- TTCTTTAGAGCTCTGCCTCAC -3'
Posted On 2014-08-25