Incidental Mutation 'R2045:Tbx6'
ID221828
Institutional Source Beutler Lab
Gene Symbol Tbx6
Ensembl Gene ENSMUSG00000030699
Gene NameT-box 6
Synonyms
MMRRC Submission 040052-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2045 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location126781483-126785560 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 126782883 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 131 (L131Q)
Ref Sequence ENSEMBL: ENSMUSP00000126418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032936] [ENSMUST00000038614] [ENSMUST00000094037] [ENSMUST00000106356] [ENSMUST00000106357] [ENSMUST00000106359] [ENSMUST00000145762] [ENSMUST00000170882] [ENSMUST00000172352] [ENSMUST00000206353] [ENSMUST00000206570] [ENSMUST00000205935] [ENSMUST00000205786]
Predicted Effect probably benign
Transcript: ENSMUST00000032936
SMART Domains Protein: ENSMUSP00000032936
Gene: ENSMUSG00000030697

DomainStartEndE-ValueType
PP2Ac 20 290 4.04e-147 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000038614
SMART Domains Protein: ENSMUSP00000037332
Gene: ENSMUSG00000042675

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 114 6.8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094037
AA Change: L131Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091579
Gene: ENSMUSG00000030699
AA Change: L131Q

DomainStartEndE-ValueType
low complexity region 55 75 N/A INTRINSIC
TBOX 90 278 1.79e-128 SMART
low complexity region 332 348 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106356
SMART Domains Protein: ENSMUSP00000101963
Gene: ENSMUSG00000042675

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 114 5.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106357
SMART Domains Protein: ENSMUSP00000101964
Gene: ENSMUSG00000042675

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 114 5.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143078
Predicted Effect probably benign
Transcript: ENSMUST00000145762
SMART Domains Protein: ENSMUSP00000115596
Gene: ENSMUSG00000042675

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 103 2.5e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156891
Predicted Effect probably benign
Transcript: ENSMUST00000170882
SMART Domains Protein: ENSMUSP00000128753
Gene: ENSMUSG00000042675

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 114 5.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172352
AA Change: L131Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126418
Gene: ENSMUSG00000030699
AA Change: L131Q

DomainStartEndE-ValueType
low complexity region 55 75 N/A INTRINSIC
TBOX 90 278 1.79e-128 SMART
low complexity region 333 349 N/A INTRINSIC
low complexity region 415 429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206261
Predicted Effect probably benign
Transcript: ENSMUST00000206570
Predicted Effect probably benign
Transcript: ENSMUST00000205935
Predicted Effect probably benign
Transcript: ENSMUST00000206334
Predicted Effect probably benign
Transcript: ENSMUST00000205786
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205950
Predicted Effect probably benign
Transcript: ENSMUST00000206477
Meta Mutation Damage Score 0.9436 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. Knockout studies in mice indicate that this gene is important for specification of paraxial mesoderm structures. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null embryos die during organogenesis exhibiting defects in paraxial mesoderm differentiation, ectopic neural tube development, kinked neural tubes, impaired somite development, hematomas, enlarged tail buds, and laterality defects associated with nodal cilium anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,399 G303E probably damaging Het
Adamts1 A T 16: 85,795,976 Y515N probably damaging Het
Ankef1 T C 2: 136,554,738 V695A probably benign Het
Ankrd63 C A 2: 118,703,353 probably benign Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Atf2 A C 2: 73,863,208 D3E probably damaging Het
Atp5f1 T C 3: 105,943,874 probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 A C 6: 118,392,627 L960W probably damaging Het
Cacna1c A G 6: 118,656,137 V977A probably damaging Het
Cadps2 A G 6: 23,839,122 S6P possibly damaging Het
Capn8 A G 1: 182,613,386 T462A probably benign Het
Cd226 T C 18: 89,207,362 S128P probably benign Het
Cd33 G T 7: 43,529,892 H278N probably benign Het
Cdh1 T C 8: 106,666,182 probably benign Het
Cfap54 T C 10: 93,038,809 probably null Het
Chit1 A G 1: 134,151,144 I397M probably benign Het
Cic C A 7: 25,271,536 Q231K possibly damaging Het
Clca4b A G 3: 144,925,163 V312A probably damaging Het
Cngb1 T A 8: 95,297,085 probably null Het
Cyfip2 T C 11: 46,249,789 I430V probably benign Het
Dnah12 A G 14: 26,781,528 E1613G probably null Het
Dock2 T C 11: 34,294,106 probably null Het
Dync2h1 A T 9: 7,160,171 F646I probably damaging Het
Eef1b2 A T 1: 63,179,487 K144* probably null Het
Erap1 T C 13: 74,669,450 V137A probably benign Het
Fam196a T G 7: 134,918,430 K124Q probably damaging Het
Far1 A T 7: 113,539,271 probably null Het
Fbn2 A T 18: 58,090,658 C807S probably damaging Het
Fgfr1 A G 8: 25,558,215 K209R probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Frem2 A T 3: 53,535,744 V2533D probably damaging Het
Hip1r T C 5: 124,000,731 M839T probably benign Het
Igfbp2 A G 1: 72,852,151 S303G probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itgb3 T G 11: 104,623,413 S27A probably benign Het
Kif21b G A 1: 136,160,313 D1015N probably damaging Het
Krt7 A T 15: 101,423,484 probably null Het
Krtdap T A 7: 30,790,585 F80L probably benign Het
Lcp1 A T 14: 75,200,401 T84S probably benign Het
Lipi G A 16: 75,550,199 T444I probably damaging Het
Lrguk A T 6: 34,071,068 E316V probably damaging Het
Lypd1 G A 1: 125,910,535 probably benign Het
Med12l A T 3: 59,262,310 K1632* probably null Het
Mrgpra9 A T 7: 47,235,835 M28K probably benign Het
Mylk A G 16: 34,953,653 K1291E probably benign Het
Nek4 T A 14: 30,953,923 W72R probably damaging Het
Nudt8 T C 19: 4,001,899 V170A probably damaging Het
Oosp3 T A 19: 11,699,369 Y31N probably benign Het
Padi2 A T 4: 140,937,930 R449W probably damaging Het
Pcf11 G T 7: 92,661,879 N300K probably damaging Het
Pcsk5 T C 19: 17,581,144 D633G possibly damaging Het
Phlpp2 T A 8: 109,907,600 W271R probably damaging Het
Pikfyve T C 1: 65,253,353 V1276A probably benign Het
Pkhd1l1 A T 15: 44,479,654 N176Y probably damaging Het
Pop5 T G 5: 115,238,212 V33G possibly damaging Het
Prkag2 A G 5: 24,947,582 F175L possibly damaging Het
Ptpn22 T A 3: 103,874,021 D79E possibly damaging Het
Rab32 T G 10: 10,550,833 D123A probably damaging Het
Rnpc3 T C 3: 113,608,360 K513E possibly damaging Het
Senp1 A T 15: 98,059,944 F358I possibly damaging Het
Sft2d2 A G 1: 165,185,078 L83P probably damaging Het
Slc9c1 G A 16: 45,580,250 R741H probably damaging Het
Smad4 A T 18: 73,649,806 Y352* probably null Het
Tamm41 T A 6: 115,016,095 Q232H probably benign Het
Trappc10 T C 10: 78,209,479 probably benign Het
Trp53bp1 C A 2: 121,204,483 A108S probably benign Het
Unc13b G A 4: 43,091,266 V31M probably damaging Het
Usp24 T C 4: 106,400,980 M1525T possibly damaging Het
Vax2 G A 6: 83,711,270 probably benign Het
Vcan T A 13: 89,690,985 I2147L probably benign Het
Zbtb7a C A 10: 81,144,410 A146E probably benign Het
Zcchc6 T C 13: 59,800,656 Y215C probably damaging Het
Zfp287 A G 11: 62,727,569 L157P probably damaging Het
Other mutations in Tbx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Tbx6 APN 7 126781529 missense probably damaging 1.00
IGL01899:Tbx6 APN 7 126784532 unclassified probably benign
R1018:Tbx6 UTSW 7 126783192 unclassified probably benign
R1126:Tbx6 UTSW 7 126784719 missense probably damaging 1.00
R4913:Tbx6 UTSW 7 126784535 critical splice acceptor site probably null
R5251:Tbx6 UTSW 7 126783344 missense probably damaging 1.00
R5926:Tbx6 UTSW 7 126784853 missense possibly damaging 0.53
R5927:Tbx6 UTSW 7 126784853 missense possibly damaging 0.53
R6285:Tbx6 UTSW 7 126781568 missense possibly damaging 0.57
R7072:Tbx6 UTSW 7 126784740 missense probably benign 0.37
R8023:Tbx6 UTSW 7 126782859 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ACAATGGCTCTTAGACTCTGC -3'
(R):5'- TGGTGAGCTTAACACGATGG -3'

Sequencing Primer
(F):5'- GACTCTGCTGGAGAACCTAGTTAC -3'
(R):5'- TGGAAGGATACGGGCTGCC -3'
Posted On2014-08-25