Incidental Mutation 'R1977:Tbxas1'
ID221837
Institutional Source Beutler Lab
Gene Symbol Tbxas1
Ensembl Gene ENSMUSG00000029925
Gene Namethromboxane A synthase 1, platelet
SynonymsTXAS, TXS, CYP5A1, CYP5
MMRRC Submission 039990-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R1977 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location38875404-39084585 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 38948641 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003017] [ENSMUST00000160963] [ENSMUST00000162521]
Predicted Effect probably benign
Transcript: ENSMUST00000003017
SMART Domains Protein: ENSMUSP00000003017
Gene: ENSMUSG00000029925

DomainStartEndE-ValueType
low complexity region 16 28 N/A INTRINSIC
Pfam:p450 44 530 1.5e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159226
Predicted Effect probably benign
Transcript: ENSMUST00000160963
SMART Domains Protein: ENSMUSP00000124640
Gene: ENSMUSG00000029925

DomainStartEndE-ValueType
Pfam:p450 30 134 3.6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161781
Predicted Effect probably benign
Transcript: ENSMUST00000162521
SMART Domains Protein: ENSMUSP00000125406
Gene: ENSMUSG00000029925

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
SCOP:d1e9xa_ 43 79 6e-6 SMART
transmembrane domain 95 117 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201966
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. However, this protein is considered a member of the cytochrome P450 superfamily on the basis of sequence similarity rather than functional similarity. This endoplasmic reticulum membrane protein catalyzes the conversion of prostglandin H2 to thromboxane A2, a potent vasoconstrictor and inducer of platelet aggregation. The enzyme plays a role in several pathophysiological processes including hemostasis, cardiovascular disease, and stroke. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null mice display increased bleeding time and decreased platelet response to arachidonic acid. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf3 G T 8: 122,781,533 C256F probably damaging Het
Adgra2 T A 8: 27,115,761 V647D possibly damaging Het
AI593442 A T 9: 52,678,192 S28R probably damaging Het
Akr1c21 G C 13: 4,574,212 G22R probably damaging Het
Ampd3 T C 7: 110,803,162 W458R probably damaging Het
Arhgap23 G T 11: 97,451,447 R185L possibly damaging Het
Arhgap45 A T 10: 80,020,818 I67F probably damaging Het
Asah1 A G 8: 41,343,517 probably null Het
Atl2 A G 17: 79,852,590 Y56H probably damaging Het
Carf A T 1: 60,146,136 I447F probably damaging Het
Crmp1 A G 5: 37,276,283 N162S probably damaging Het
Cyp2a5 A G 7: 26,835,922 E103G probably benign Het
Cyp2c40 T C 19: 39,778,041 D370G probably damaging Het
Dhrs2 T A 14: 55,234,655 M1K probably null Het
Dnah17 T C 11: 118,112,591 E810G possibly damaging Het
E2f5 T A 3: 14,587,356 I84N probably damaging Het
Eif2ak4 A T 2: 118,461,757 K1185* probably null Het
Eif4ebp1 T A 8: 27,275,101 M115K probably damaging Het
Evi5 A T 5: 107,799,139 L505* probably null Het
Fbxw25 T A 9: 109,652,856 Y254F possibly damaging Het
Gm7964 T A 7: 83,757,352 F439Y possibly damaging Het
Gps1 A G 11: 120,785,826 T124A probably damaging Het
Hopx T C 5: 77,117,616 probably benign Het
Hoxd3 A G 2: 74,744,276 S89G possibly damaging Het
Hrc A T 7: 45,336,214 D263V probably damaging Het
Hs6st3 T C 14: 119,138,476 I21T probably benign Het
Izumo4 A G 10: 80,703,121 Y106C probably damaging Het
Lama2 A T 10: 26,990,800 probably null Het
Lcorl A C 5: 45,775,420 S123R probably null Het
Lgr4 A T 2: 110,011,928 I729F probably damaging Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Matn3 T A 12: 8,961,110 probably benign Het
Mdc1 T A 17: 35,850,930 S912T probably benign Het
Mgam G A 6: 40,664,880 V556I probably benign Het
Myom2 A T 8: 15,085,263 I489F possibly damaging Het
Nfatc2 G A 2: 168,504,459 T905I possibly damaging Het
Nme6 G A 9: 109,835,341 R6Q probably damaging Het
Nr1h5 A G 3: 102,947,817 S323P probably damaging Het
Nr4a3 C A 4: 48,056,539 R364S probably damaging Het
Obox7 A T 7: 14,664,398 D79V probably damaging Het
Olfr167 G A 16: 19,514,836 P267S probably damaging Het
Olfr374 G A 8: 72,109,854 G96D probably benign Het
Olfr435 T A 6: 43,201,980 V112D possibly damaging Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Parp8 T A 13: 116,910,913 I208F probably damaging Het
Pdgfc C T 3: 81,209,245 T302I probably damaging Het
Pnpt1 A G 11: 29,141,256 I337V probably benign Het
Polk T C 13: 96,489,228 E436G probably damaging Het
Pramel7 A G 2: 87,491,121 V190A probably benign Het
Rplp2 T C 7: 141,448,781 probably benign Het
Sec23ip T A 7: 128,766,273 S670T probably damaging Het
Sgk2 A G 2: 163,004,160 N207S probably benign Het
Sh2d2a C T 3: 87,851,816 Q242* probably null Het
Sh3pxd2b A C 11: 32,422,138 N435T probably damaging Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Stx17 G A 4: 48,181,553 V241M probably benign Het
Taok3 A T 5: 117,265,924 K721N probably damaging Het
Tmem87a G A 2: 120,374,504 A377V probably benign Het
Topaz1 C T 9: 122,747,362 T6M unknown Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Vmn2r125 A G 4: 156,354,591 probably null Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Wdr59 A T 8: 111,458,638 C888S probably benign Het
Other mutations in Tbxas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Tbxas1 APN 6 39021181 missense probably damaging 0.97
IGL01319:Tbxas1 APN 6 39017973 missense probably benign 0.09
IGL01633:Tbxas1 APN 6 38982191 missense probably benign 0.00
IGL01712:Tbxas1 APN 6 39081060 missense probably benign 0.00
IGL01860:Tbxas1 APN 6 38948627 missense probably damaging 1.00
IGL01964:Tbxas1 APN 6 39083814 missense probably benign 0.00
IGL02036:Tbxas1 APN 6 39021157 missense probably benign
IGL02335:Tbxas1 APN 6 39023080 missense probably damaging 1.00
IGL02615:Tbxas1 APN 6 39027866 missense probably damaging 1.00
R0245:Tbxas1 UTSW 6 39027768 missense probably benign 0.00
R1677:Tbxas1 UTSW 6 39017888 splice site probably benign
R1975:Tbxas1 UTSW 6 38948641 splice site probably benign
R2308:Tbxas1 UTSW 6 39027661 missense probably benign 0.08
R4394:Tbxas1 UTSW 6 39027779 missense probably benign 0.19
R4702:Tbxas1 UTSW 6 39083857 critical splice donor site probably null
R4703:Tbxas1 UTSW 6 39083857 critical splice donor site probably null
R4705:Tbxas1 UTSW 6 39083857 critical splice donor site probably null
R4935:Tbxas1 UTSW 6 39023047 missense probably benign 0.02
R5424:Tbxas1 UTSW 6 39027905 missense possibly damaging 0.72
R5704:Tbxas1 UTSW 6 39021133 missense probably benign 0.20
R6358:Tbxas1 UTSW 6 38952112 intron probably benign
R6455:Tbxas1 UTSW 6 38952145 intron probably benign
R6823:Tbxas1 UTSW 6 38919153 start codon destroyed possibly damaging 0.94
R6868:Tbxas1 UTSW 6 39084306 missense probably damaging 1.00
R6888:Tbxas1 UTSW 6 38952074 intron probably benign
R7500:Tbxas1 UTSW 6 38982212 nonsense probably null
R8026:Tbxas1 UTSW 6 39027896 missense probably benign 0.12
R8351:Tbxas1 UTSW 6 39027916 missense possibly damaging 0.67
R8729:Tbxas1 UTSW 6 39001338 missense probably benign 0.33
R8837:Tbxas1 UTSW 6 39071430 missense
Z1177:Tbxas1 UTSW 6 39021104 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGAAACTTCTCTCAGCCTCG -3'
(R):5'- GTTGCACAGTGACCTTGAGAG -3'

Sequencing Primer
(F):5'- GAAACTTCTCTCAGCCTCGCTAAG -3'
(R):5'- GTATAAAGTCAGCCTTGGCAGCC -3'
Posted On2014-08-25