Incidental Mutation 'R2045:Trappc10'
ID221847
Institutional Source Beutler Lab
Gene Symbol Trappc10
Ensembl Gene ENSMUSG00000000374
Gene Nametrafficking protein particle complex 10
SynonymsTmem1, LOC380642, B230307C21Rik
MMRRC Submission 040052-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2045 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location78186725-78244641 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 78209479 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000000384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000384]
Predicted Effect probably benign
Transcript: ENSMUST00000000384
SMART Domains Protein: ENSMUSP00000000384
Gene: ENSMUSG00000000374

DomainStartEndE-ValueType
Pfam:TRAPPC10 1016 1245 1.1e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218124
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane protein found in the cis-Golgi complex. The encoded protein is part of the multisubunit transport protein particle (TRAPP) complex and may be involved in vesicular transport from the endoplasmic reticulum to the Golgi. Mutations in this gene could be responsible for the Unverricht-Lundborg type of progressive myoclonus epilepsy, or for autoimmune polyglandular disease type 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit cardiovascular phenotypes, including atrioventricular or ventricular septal defects, thymus hypoplasia, and eye defects such as microphthalmia or anophthalmia. Holoprosencephaly, anencephaly and severe craniofacial defects may be also present. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,399 G303E probably damaging Het
Adamts1 A T 16: 85,795,976 Y515N probably damaging Het
Ankef1 T C 2: 136,554,738 V695A probably benign Het
Ankrd63 C A 2: 118,703,353 probably benign Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Atf2 A C 2: 73,863,208 D3E probably damaging Het
Atp5f1 T C 3: 105,943,874 probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 A C 6: 118,392,627 L960W probably damaging Het
Cacna1c A G 6: 118,656,137 V977A probably damaging Het
Cadps2 A G 6: 23,839,122 S6P possibly damaging Het
Capn8 A G 1: 182,613,386 T462A probably benign Het
Cd226 T C 18: 89,207,362 S128P probably benign Het
Cd33 G T 7: 43,529,892 H278N probably benign Het
Cdh1 T C 8: 106,666,182 probably benign Het
Cfap54 T C 10: 93,038,809 probably null Het
Chit1 A G 1: 134,151,144 I397M probably benign Het
Cic C A 7: 25,271,536 Q231K possibly damaging Het
Clca4b A G 3: 144,925,163 V312A probably damaging Het
Cngb1 T A 8: 95,297,085 probably null Het
Cyfip2 T C 11: 46,249,789 I430V probably benign Het
Dnah12 A G 14: 26,781,528 E1613G probably null Het
Dock2 T C 11: 34,294,106 probably null Het
Dync2h1 A T 9: 7,160,171 F646I probably damaging Het
Eef1b2 A T 1: 63,179,487 K144* probably null Het
Erap1 T C 13: 74,669,450 V137A probably benign Het
Fam196a T G 7: 134,918,430 K124Q probably damaging Het
Far1 A T 7: 113,539,271 probably null Het
Fbn2 A T 18: 58,090,658 C807S probably damaging Het
Fgfr1 A G 8: 25,558,215 K209R probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Frem2 A T 3: 53,535,744 V2533D probably damaging Het
Hip1r T C 5: 124,000,731 M839T probably benign Het
Igfbp2 A G 1: 72,852,151 S303G probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itgb3 T G 11: 104,623,413 S27A probably benign Het
Kif21b G A 1: 136,160,313 D1015N probably damaging Het
Krt7 A T 15: 101,423,484 probably null Het
Krtdap T A 7: 30,790,585 F80L probably benign Het
Lcp1 A T 14: 75,200,401 T84S probably benign Het
Lipi G A 16: 75,550,199 T444I probably damaging Het
Lrguk A T 6: 34,071,068 E316V probably damaging Het
Lypd1 G A 1: 125,910,535 probably benign Het
Med12l A T 3: 59,262,310 K1632* probably null Het
Mrgpra9 A T 7: 47,235,835 M28K probably benign Het
Mylk A G 16: 34,953,653 K1291E probably benign Het
Nek4 T A 14: 30,953,923 W72R probably damaging Het
Nudt8 T C 19: 4,001,899 V170A probably damaging Het
Oosp3 T A 19: 11,699,369 Y31N probably benign Het
Padi2 A T 4: 140,937,930 R449W probably damaging Het
Pcf11 G T 7: 92,661,879 N300K probably damaging Het
Pcsk5 T C 19: 17,581,144 D633G possibly damaging Het
Phlpp2 T A 8: 109,907,600 W271R probably damaging Het
Pikfyve T C 1: 65,253,353 V1276A probably benign Het
Pkhd1l1 A T 15: 44,479,654 N176Y probably damaging Het
Pop5 T G 5: 115,238,212 V33G possibly damaging Het
Prkag2 A G 5: 24,947,582 F175L possibly damaging Het
Ptpn22 T A 3: 103,874,021 D79E possibly damaging Het
Rab32 T G 10: 10,550,833 D123A probably damaging Het
Rnpc3 T C 3: 113,608,360 K513E possibly damaging Het
Senp1 A T 15: 98,059,944 F358I possibly damaging Het
Sft2d2 A G 1: 165,185,078 L83P probably damaging Het
Slc9c1 G A 16: 45,580,250 R741H probably damaging Het
Smad4 A T 18: 73,649,806 Y352* probably null Het
Tamm41 T A 6: 115,016,095 Q232H probably benign Het
Tbx6 T A 7: 126,782,883 L131Q probably damaging Het
Trp53bp1 C A 2: 121,204,483 A108S probably benign Het
Unc13b G A 4: 43,091,266 V31M probably damaging Het
Usp24 T C 4: 106,400,980 M1525T possibly damaging Het
Vax2 G A 6: 83,711,270 probably benign Het
Vcan T A 13: 89,690,985 I2147L probably benign Het
Zbtb7a C A 10: 81,144,410 A146E probably benign Het
Zcchc6 T C 13: 59,800,656 Y215C probably damaging Het
Zfp287 A G 11: 62,727,569 L157P probably damaging Het
Other mutations in Trappc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Trappc10 APN 10 78203877 splice site probably benign
IGL01375:Trappc10 APN 10 78188899 missense possibly damaging 0.75
IGL01413:Trappc10 APN 10 78197844 missense possibly damaging 0.87
IGL02413:Trappc10 APN 10 78210776 missense probably damaging 0.99
IGL03037:Trappc10 APN 10 78199035 unclassified probably benign
IGL03094:Trappc10 APN 10 78228920 splice site probably benign
IGL03164:Trappc10 APN 10 78220242 missense probably damaging 1.00
IGL03351:Trappc10 APN 10 78188761 missense probably damaging 1.00
IGL03055:Trappc10 UTSW 10 78214686 missense probably damaging 1.00
IGL03098:Trappc10 UTSW 10 78214686 missense probably damaging 1.00
R0304:Trappc10 UTSW 10 78210760 splice site probably benign
R0605:Trappc10 UTSW 10 78201497 missense possibly damaging 0.70
R1806:Trappc10 UTSW 10 78210776 missense probably damaging 0.99
R1856:Trappc10 UTSW 10 78196451 missense probably benign 0.00
R2088:Trappc10 UTSW 10 78196334 missense probably benign 0.00
R2126:Trappc10 UTSW 10 78203924 missense possibly damaging 0.94
R2202:Trappc10 UTSW 10 78199042 critical splice donor site probably null
R2509:Trappc10 UTSW 10 78211523 missense possibly damaging 0.51
R2510:Trappc10 UTSW 10 78211523 missense possibly damaging 0.51
R2511:Trappc10 UTSW 10 78211523 missense possibly damaging 0.51
R2893:Trappc10 UTSW 10 78193401 missense probably benign 0.00
R3744:Trappc10 UTSW 10 78199090 missense probably benign 0.00
R3778:Trappc10 UTSW 10 78200802 missense possibly damaging 0.89
R3876:Trappc10 UTSW 10 78220186 splice site probably null
R3930:Trappc10 UTSW 10 78210403 missense probably benign 0.03
R4078:Trappc10 UTSW 10 78210382 missense probably damaging 1.00
R4111:Trappc10 UTSW 10 78196430 missense probably benign 0.09
R4418:Trappc10 UTSW 10 78217188 missense probably damaging 1.00
R4549:Trappc10 UTSW 10 78231458 missense probably damaging 1.00
R4695:Trappc10 UTSW 10 78197863 missense probably damaging 0.99
R4799:Trappc10 UTSW 10 78201590 missense possibly damaging 0.71
R5022:Trappc10 UTSW 10 78217160 missense possibly damaging 0.72
R5023:Trappc10 UTSW 10 78217160 missense possibly damaging 0.72
R5026:Trappc10 UTSW 10 78204288 missense possibly damaging 0.82
R5057:Trappc10 UTSW 10 78217160 missense possibly damaging 0.72
R5282:Trappc10 UTSW 10 78187860 missense probably damaging 1.00
R5363:Trappc10 UTSW 10 78188840 missense possibly damaging 0.92
R5813:Trappc10 UTSW 10 78222739 missense probably damaging 1.00
R5831:Trappc10 UTSW 10 78209426 missense probably damaging 1.00
R6209:Trappc10 UTSW 10 78214812 missense possibly damaging 0.50
R6450:Trappc10 UTSW 10 78209450 missense possibly damaging 0.92
R6520:Trappc10 UTSW 10 78201453 missense probably benign 0.00
R6533:Trappc10 UTSW 10 78188894 missense probably damaging 0.96
R6767:Trappc10 UTSW 10 78193511 missense possibly damaging 0.75
R6798:Trappc10 UTSW 10 78188831 missense probably benign 0.00
R7205:Trappc10 UTSW 10 78210428 missense probably damaging 1.00
R7282:Trappc10 UTSW 10 78207493 missense probably damaging 0.98
R7378:Trappc10 UTSW 10 78193418 missense probably damaging 0.96
R7384:Trappc10 UTSW 10 78209384 missense possibly damaging 0.85
R7770:Trappc10 UTSW 10 78210845 missense probably damaging 0.96
R7829:Trappc10 UTSW 10 78199075 missense probably benign
R7839:Trappc10 UTSW 10 78188812 missense possibly damaging 0.84
R8298:Trappc10 UTSW 10 78202919 missense probably damaging 1.00
R8306:Trappc10 UTSW 10 78200626 missense possibly damaging 0.54
Z1177:Trappc10 UTSW 10 78217153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTGGCTAGTGGATTCTACC -3'
(R):5'- GTGCCCTGAGAGTTCAAGTAC -3'

Sequencing Primer
(F):5'- ACTGGCTAGTGGATTCTACCTGTTTC -3'
(R):5'- CCCTGAGAGTTCAAGTACAGGGC -3'
Posted On2014-08-25