Incidental Mutation 'R2045:Zbtb7a'
ID221849
Institutional Source Beutler Lab
Gene Symbol Zbtb7a
Ensembl Gene ENSMUSG00000035011
Gene Namezinc finger and BTB domain containing 7a
SynonymsLeukemia/lymphoma Related Factor, 9030619K07Rik, 9130006G12Rik, FBI-1, Pokemon, Lrf, Zbtb7
MMRRC Submission 040052-MU
Accession Numbers

Genbank: NM_010731; MGI: 1335091

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2045 (G1)
Quality Score194
Status Validated
Chromosome10
Chromosomal Location81135220-81152995 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 81144410 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 146 (A146E)
Ref Sequence ENSEMBL: ENSMUSP00000113612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048128] [ENSMUST00000117956] [ENSMUST00000119606] [ENSMUST00000121840] [ENSMUST00000125261] [ENSMUST00000146895]
Predicted Effect probably benign
Transcript: ENSMUST00000048128
AA Change: A146E

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000047333
Gene: ENSMUSG00000035011
AA Change: A146E

DomainStartEndE-ValueType
BTB 34 131 5.01e-30 SMART
low complexity region 195 205 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
low complexity region 245 261 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
ZnF_C2H2 376 398 7.55e-1 SMART
ZnF_C2H2 404 426 2.79e-4 SMART
ZnF_C2H2 432 454 1.58e-3 SMART
ZnF_C2H2 460 480 5.4e1 SMART
low complexity region 486 519 N/A INTRINSIC
low complexity region 528 535 N/A INTRINSIC
low complexity region 546 563 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117956
AA Change: A146E

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000113428
Gene: ENSMUSG00000035011
AA Change: A146E

DomainStartEndE-ValueType
BTB 34 131 5.01e-30 SMART
low complexity region 195 205 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
low complexity region 245 261 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
ZnF_C2H2 376 398 7.55e-1 SMART
ZnF_C2H2 404 426 2.79e-4 SMART
ZnF_C2H2 432 454 1.58e-3 SMART
ZnF_C2H2 460 480 5.4e1 SMART
low complexity region 486 519 N/A INTRINSIC
low complexity region 528 535 N/A INTRINSIC
low complexity region 546 563 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119606
AA Change: A146E

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000113612
Gene: ENSMUSG00000035011
AA Change: A146E

DomainStartEndE-ValueType
BTB 34 131 5.01e-30 SMART
low complexity region 195 205 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
low complexity region 245 261 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
ZnF_C2H2 376 398 7.55e-1 SMART
ZnF_C2H2 404 426 2.79e-4 SMART
ZnF_C2H2 432 454 1.58e-3 SMART
ZnF_C2H2 460 480 5.4e1 SMART
low complexity region 486 519 N/A INTRINSIC
low complexity region 528 535 N/A INTRINSIC
low complexity region 546 563 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121840
AA Change: A146E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000113787
Gene: ENSMUSG00000035011
AA Change: A146E

DomainStartEndE-ValueType
BTB 34 131 5.01e-30 SMART
low complexity region 195 205 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
low complexity region 245 261 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
ZnF_C2H2 376 398 7.55e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125261
AA Change: A146E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114470
Gene: ENSMUSG00000035011
AA Change: A146E

DomainStartEndE-ValueType
BTB 34 131 5.01e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146895
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (74/74)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die around E16.5 due to anemia and exhibit a cell autonomous defect in early B cell development. [provided by MGI curators]
Allele List at MGI

All alleles(58) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(54)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,399 G303E probably damaging Het
Adamts1 A T 16: 85,795,976 Y515N probably damaging Het
Ankef1 T C 2: 136,554,738 V695A probably benign Het
Ankrd63 C A 2: 118,703,353 probably benign Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Atf2 A C 2: 73,863,208 D3E probably damaging Het
Atp5f1 T C 3: 105,943,874 probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 A C 6: 118,392,627 L960W probably damaging Het
Cacna1c A G 6: 118,656,137 V977A probably damaging Het
Cadps2 A G 6: 23,839,122 S6P possibly damaging Het
Capn8 A G 1: 182,613,386 T462A probably benign Het
Cd226 T C 18: 89,207,362 S128P probably benign Het
Cd33 G T 7: 43,529,892 H278N probably benign Het
Cdh1 T C 8: 106,666,182 probably benign Het
Cfap54 T C 10: 93,038,809 probably null Het
Chit1 A G 1: 134,151,144 I397M probably benign Het
Cic C A 7: 25,271,536 Q231K possibly damaging Het
Clca4b A G 3: 144,925,163 V312A probably damaging Het
Cngb1 T A 8: 95,297,085 probably null Het
Cyfip2 T C 11: 46,249,789 I430V probably benign Het
Dnah12 A G 14: 26,781,528 E1613G probably null Het
Dock2 T C 11: 34,294,106 probably null Het
Dync2h1 A T 9: 7,160,171 F646I probably damaging Het
Eef1b2 A T 1: 63,179,487 K144* probably null Het
Erap1 T C 13: 74,669,450 V137A probably benign Het
Fam196a T G 7: 134,918,430 K124Q probably damaging Het
Far1 A T 7: 113,539,271 probably null Het
Fbn2 A T 18: 58,090,658 C807S probably damaging Het
Fgfr1 A G 8: 25,558,215 K209R probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Frem2 A T 3: 53,535,744 V2533D probably damaging Het
Hip1r T C 5: 124,000,731 M839T probably benign Het
Igfbp2 A G 1: 72,852,151 S303G probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itgb3 T G 11: 104,623,413 S27A probably benign Het
Kif21b G A 1: 136,160,313 D1015N probably damaging Het
Krt7 A T 15: 101,423,484 probably null Het
Krtdap T A 7: 30,790,585 F80L probably benign Het
Lcp1 A T 14: 75,200,401 T84S probably benign Het
Lipi G A 16: 75,550,199 T444I probably damaging Het
Lrguk A T 6: 34,071,068 E316V probably damaging Het
Lypd1 G A 1: 125,910,535 probably benign Het
Med12l A T 3: 59,262,310 K1632* probably null Het
Mrgpra9 A T 7: 47,235,835 M28K probably benign Het
Mylk A G 16: 34,953,653 K1291E probably benign Het
Nek4 T A 14: 30,953,923 W72R probably damaging Het
Nudt8 T C 19: 4,001,899 V170A probably damaging Het
Oosp3 T A 19: 11,699,369 Y31N probably benign Het
Padi2 A T 4: 140,937,930 R449W probably damaging Het
Pcf11 G T 7: 92,661,879 N300K probably damaging Het
Pcsk5 T C 19: 17,581,144 D633G possibly damaging Het
Phlpp2 T A 8: 109,907,600 W271R probably damaging Het
Pikfyve T C 1: 65,253,353 V1276A probably benign Het
Pkhd1l1 A T 15: 44,479,654 N176Y probably damaging Het
Pop5 T G 5: 115,238,212 V33G possibly damaging Het
Prkag2 A G 5: 24,947,582 F175L possibly damaging Het
Ptpn22 T A 3: 103,874,021 D79E possibly damaging Het
Rab32 T G 10: 10,550,833 D123A probably damaging Het
Rnpc3 T C 3: 113,608,360 K513E possibly damaging Het
Senp1 A T 15: 98,059,944 F358I possibly damaging Het
Sft2d2 A G 1: 165,185,078 L83P probably damaging Het
Slc9c1 G A 16: 45,580,250 R741H probably damaging Het
Smad4 A T 18: 73,649,806 Y352* probably null Het
Tamm41 T A 6: 115,016,095 Q232H probably benign Het
Tbx6 T A 7: 126,782,883 L131Q probably damaging Het
Trappc10 T C 10: 78,209,479 probably benign Het
Trp53bp1 C A 2: 121,204,483 A108S probably benign Het
Unc13b G A 4: 43,091,266 V31M probably damaging Het
Usp24 T C 4: 106,400,980 M1525T possibly damaging Het
Vax2 G A 6: 83,711,270 probably benign Het
Vcan T A 13: 89,690,985 I2147L probably benign Het
Zcchc6 T C 13: 59,800,656 Y215C probably damaging Het
Zfp287 A G 11: 62,727,569 L157P probably damaging Het
Other mutations in Zbtb7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02937:Zbtb7a APN 10 81144298 missense probably benign 0.30
Bushel UTSW 10 81148329 missense probably benign 0.01
dram UTSW 10 81144266 missense probably damaging 1.00
Gallon UTSW 10 81144440 missense probably damaging 1.00
peck UTSW 10 81143986 missense probably damaging 1.00
D6062:Zbtb7a UTSW 10 81144358 missense probably damaging 0.99
R0529:Zbtb7a UTSW 10 81143986 missense probably damaging 1.00
R0562:Zbtb7a UTSW 10 81148329 missense probably benign 0.01
R2275:Zbtb7a UTSW 10 81144997 missense possibly damaging 0.95
R3755:Zbtb7a UTSW 10 81144266 missense probably damaging 1.00
R3883:Zbtb7a UTSW 10 81148025 missense probably damaging 1.00
R4723:Zbtb7a UTSW 10 81144440 missense probably damaging 1.00
R5503:Zbtb7a UTSW 10 81144797 missense probably damaging 0.96
R5650:Zbtb7a UTSW 10 81145049 missense probably damaging 1.00
R6872:Zbtb7a UTSW 10 81148071 missense possibly damaging 0.95
R7196:Zbtb7a UTSW 10 81144600 missense probably damaging 0.99
R7558:Zbtb7a UTSW 10 81148435 makesense probably null
R7602:Zbtb7a UTSW 10 81144176 missense probably damaging 0.99
R8220:Zbtb7a UTSW 10 81145004 missense probably damaging 0.99
R8317:Zbtb7a UTSW 10 81144950 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- AGATCGACTTCGTGAGTGCC -3'
(R):5'- AGAAGTCCAAGCCATTGCAGTC -3'

Sequencing Primer
(F):5'- TGACGGCGCTCATGGACTTC -3'
(R):5'- AAGCCATTGCAGTCGCCTG -3'
Posted On2014-08-25