Incidental Mutation 'R1977:Myom2'
ID 221858
Institutional Source Beutler Lab
Gene Symbol Myom2
Ensembl Gene ENSMUSG00000031461
Gene Name myomesin 2
Synonyms
MMRRC Submission 039990-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.149) question?
Stock # R1977 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 15107653-15183410 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 15135263 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 489 (I489F)
Ref Sequence ENSEMBL: ENSMUSP00000033842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033842]
AlphaFold Q14BI5
Predicted Effect possibly damaging
Transcript: ENSMUST00000033842
AA Change: I489F

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000033842
Gene: ENSMUSG00000031461
AA Change: I489F

DomainStartEndE-ValueType
low complexity region 34 63 N/A INTRINSIC
low complexity region 79 87 N/A INTRINSIC
coiled coil region 97 129 N/A INTRINSIC
IG 160 247 7.7e-5 SMART
IG 284 373 8.01e-3 SMART
FN3 383 466 1.5e-14 SMART
FN3 511 594 1.79e-12 SMART
FN3 612 693 1.95e-13 SMART
FN3 711 794 8.69e-11 SMART
FN3 813 896 1.86e-10 SMART
IG_like 913 999 1.58e2 SMART
Blast:IG_like 1021 1106 1e-44 BLAST
IG_like 1135 1215 2.27e1 SMART
Blast:IG_like 1227 1321 9e-51 BLAST
IGc2 1357 1425 4.96e-8 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD and 165 kD. The predicted MYOM2 protein contains 1,465 amino acids. Like MYOM1, MYOM2 has a unique N-terminal domain followed by 12 repeat domains with strong homology to either fibronectin type III or immunoglobulin C2 domains. Protein sequence comparisons suggested that the MYOM2 protein and bovine M protein are identical. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf3 G T 8: 123,508,272 (GRCm39) C256F probably damaging Het
Adgra2 T A 8: 27,605,789 (GRCm39) V647D possibly damaging Het
AI593442 A T 9: 52,589,492 (GRCm39) S28R probably damaging Het
Akr1c21 G C 13: 4,624,211 (GRCm39) G22R probably damaging Het
Ampd3 T C 7: 110,402,369 (GRCm39) W458R probably damaging Het
Arhgap23 G T 11: 97,342,273 (GRCm39) R185L possibly damaging Het
Arhgap45 A T 10: 79,856,652 (GRCm39) I67F probably damaging Het
Asah1 A G 8: 41,796,554 (GRCm39) probably null Het
Atl2 A G 17: 80,160,019 (GRCm39) Y56H probably damaging Het
Carf A T 1: 60,185,295 (GRCm39) I447F probably damaging Het
Crmp1 A G 5: 37,433,627 (GRCm39) N162S probably damaging Het
Cyp2a5 A G 7: 26,535,347 (GRCm39) E103G probably benign Het
Cyp2c40 T C 19: 39,766,485 (GRCm39) D370G probably damaging Het
Dhrs2 T A 14: 55,472,112 (GRCm39) M1K probably null Het
Dnah17 T C 11: 118,003,417 (GRCm39) E810G possibly damaging Het
E2f5 T A 3: 14,652,416 (GRCm39) I84N probably damaging Het
Eif2ak4 A T 2: 118,292,238 (GRCm39) K1185* probably null Het
Eif4ebp1 T A 8: 27,765,129 (GRCm39) M115K probably damaging Het
Evi5 A T 5: 107,947,005 (GRCm39) L505* probably null Het
Fbxw25 T A 9: 109,481,924 (GRCm39) Y254F possibly damaging Het
Gm7964 T A 7: 83,406,560 (GRCm39) F439Y possibly damaging Het
Gps1 A G 11: 120,676,652 (GRCm39) T124A probably damaging Het
Hopx T C 5: 77,265,463 (GRCm39) probably benign Het
Hoxd3 A G 2: 74,574,620 (GRCm39) S89G possibly damaging Het
Hrc A T 7: 44,985,638 (GRCm39) D263V probably damaging Het
Hs6st3 T C 14: 119,375,888 (GRCm39) I21T probably benign Het
Izumo4 A G 10: 80,538,955 (GRCm39) Y106C probably damaging Het
Lama2 A T 10: 26,866,796 (GRCm39) probably null Het
Lcorl A C 5: 45,932,762 (GRCm39) S123R probably null Het
Lgr4 A T 2: 109,842,273 (GRCm39) I729F probably damaging Het
Lonp1 T C 17: 56,922,068 (GRCm39) T771A possibly damaging Het
Matn3 T A 12: 9,011,110 (GRCm39) probably benign Het
Mdc1 T A 17: 36,161,822 (GRCm39) S912T probably benign Het
Mgam G A 6: 40,641,814 (GRCm39) V556I probably benign Het
Nfatc2 G A 2: 168,346,379 (GRCm39) T905I possibly damaging Het
Nme6 G A 9: 109,664,409 (GRCm39) R6Q probably damaging Het
Nr1h5 A G 3: 102,855,133 (GRCm39) S323P probably damaging Het
Nr4a3 C A 4: 48,056,539 (GRCm39) R364S probably damaging Het
Obox7 A T 7: 14,398,323 (GRCm39) D79V probably damaging Het
Or1ab2 G A 8: 72,863,698 (GRCm39) G96D probably benign Het
Or2a51 T A 6: 43,178,914 (GRCm39) V112D possibly damaging Het
Or2l5 G A 16: 19,333,586 (GRCm39) P267S probably damaging Het
Pan2 T C 10: 128,156,282 (GRCm39) V1171A probably damaging Het
Parp8 T A 13: 117,047,449 (GRCm39) I208F probably damaging Het
Pdgfc C T 3: 81,116,552 (GRCm39) T302I probably damaging Het
Pnpt1 A G 11: 29,091,256 (GRCm39) I337V probably benign Het
Polk T C 13: 96,625,736 (GRCm39) E436G probably damaging Het
Pramel7 A G 2: 87,321,465 (GRCm39) V190A probably benign Het
Rplp2 T C 7: 141,028,694 (GRCm39) probably benign Het
Sec23ip T A 7: 128,367,997 (GRCm39) S670T probably damaging Het
Sgk2 A G 2: 162,846,080 (GRCm39) N207S probably benign Het
Sh2d2a C T 3: 87,759,123 (GRCm39) Q242* probably null Het
Sh3pxd2b A C 11: 32,372,138 (GRCm39) N435T probably damaging Het
Slc36a4 T A 9: 15,645,506 (GRCm39) V311D probably damaging Het
Stx17 G A 4: 48,181,553 (GRCm39) V241M probably benign Het
Taok3 A T 5: 117,403,989 (GRCm39) K721N probably damaging Het
Tbxas1 A G 6: 38,925,575 (GRCm39) probably benign Het
Tmem87a G A 2: 120,204,985 (GRCm39) A377V probably benign Het
Topaz1 C T 9: 122,576,427 (GRCm39) T6M unknown Het
Tspan8 A G 10: 115,680,035 (GRCm39) I217V probably benign Het
Vmn2r125 A G 4: 156,707,162 (GRCm39) probably null Het
Vmn2r5 C T 3: 64,411,642 (GRCm39) E309K probably damaging Het
Wdr59 A T 8: 112,185,270 (GRCm39) C888S probably benign Het
Other mutations in Myom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom2 APN 8 15,119,490 (GRCm39) missense probably damaging 1.00
IGL00426:Myom2 APN 8 15,119,502 (GRCm39) missense probably benign 0.00
IGL00503:Myom2 APN 8 15,164,289 (GRCm39) splice site probably null
IGL01515:Myom2 APN 8 15,172,655 (GRCm39) missense probably benign 0.15
IGL01649:Myom2 APN 8 15,163,755 (GRCm39) missense probably benign 0.24
IGL01658:Myom2 APN 8 15,127,880 (GRCm39) missense probably damaging 1.00
IGL01786:Myom2 APN 8 15,156,330 (GRCm39) missense probably damaging 0.99
IGL01924:Myom2 APN 8 15,119,685 (GRCm39) missense probably benign 0.37
IGL01929:Myom2 APN 8 15,167,698 (GRCm39) missense probably damaging 0.96
IGL02016:Myom2 APN 8 15,175,195 (GRCm39) missense probably benign 0.01
IGL02511:Myom2 APN 8 15,115,743 (GRCm39) missense probably benign
IGL02558:Myom2 APN 8 15,164,237 (GRCm39) missense probably benign 0.31
IGL02944:Myom2 APN 8 15,154,065 (GRCm39) critical splice acceptor site probably null
IGL03052:Myom2 APN 8 15,173,442 (GRCm39) splice site probably benign
IGL03195:Myom2 APN 8 15,161,844 (GRCm39) nonsense probably null
IGL03288:Myom2 APN 8 15,172,679 (GRCm39) missense probably damaging 0.99
IGL03402:Myom2 APN 8 15,115,731 (GRCm39) missense probably benign
yomama UTSW 8 15,182,895 (GRCm39) missense probably benign 0.10
yoyoma UTSW 8 15,182,667 (GRCm39) missense probably damaging 0.99
R0069:Myom2 UTSW 8 15,167,624 (GRCm39) missense probably benign
R0116:Myom2 UTSW 8 15,167,633 (GRCm39) missense probably damaging 1.00
R0131:Myom2 UTSW 8 15,133,329 (GRCm39) missense probably damaging 0.98
R0373:Myom2 UTSW 8 15,148,419 (GRCm39) missense possibly damaging 0.91
R0463:Myom2 UTSW 8 15,154,123 (GRCm39) missense probably benign 0.09
R0544:Myom2 UTSW 8 15,119,796 (GRCm39) missense probably damaging 1.00
R0629:Myom2 UTSW 8 15,119,783 (GRCm39) missense probably damaging 0.98
R0634:Myom2 UTSW 8 15,169,216 (GRCm39) splice site probably benign
R0645:Myom2 UTSW 8 15,167,698 (GRCm39) missense probably damaging 0.96
R0730:Myom2 UTSW 8 15,149,326 (GRCm39) missense probably benign 0.00
R0744:Myom2 UTSW 8 15,182,924 (GRCm39) nonsense probably null
R0836:Myom2 UTSW 8 15,182,924 (GRCm39) nonsense probably null
R1033:Myom2 UTSW 8 15,158,934 (GRCm39) missense probably benign 0.04
R1103:Myom2 UTSW 8 15,160,827 (GRCm39) missense probably benign 0.22
R1110:Myom2 UTSW 8 15,172,413 (GRCm39) missense probably benign 0.44
R1208:Myom2 UTSW 8 15,134,631 (GRCm39) missense probably damaging 1.00
R1208:Myom2 UTSW 8 15,134,631 (GRCm39) missense probably damaging 1.00
R1353:Myom2 UTSW 8 15,156,424 (GRCm39) missense probably damaging 1.00
R1530:Myom2 UTSW 8 15,172,384 (GRCm39) missense probably damaging 1.00
R1544:Myom2 UTSW 8 15,154,059 (GRCm39) splice site probably benign
R1576:Myom2 UTSW 8 15,134,556 (GRCm39) missense probably damaging 1.00
R1758:Myom2 UTSW 8 15,115,795 (GRCm39) missense probably benign 0.00
R1884:Myom2 UTSW 8 15,164,278 (GRCm39) missense probably benign 0.01
R1908:Myom2 UTSW 8 15,131,023 (GRCm39) missense probably damaging 1.00
R1962:Myom2 UTSW 8 15,182,599 (GRCm39) splice site probably null
R2018:Myom2 UTSW 8 15,181,151 (GRCm39) missense probably damaging 1.00
R2049:Myom2 UTSW 8 15,156,379 (GRCm39) missense probably damaging 0.97
R2155:Myom2 UTSW 8 15,134,555 (GRCm39) missense probably damaging 0.98
R2314:Myom2 UTSW 8 15,113,927 (GRCm39) missense probably damaging 0.99
R2350:Myom2 UTSW 8 15,158,835 (GRCm39) missense probably benign 0.09
R2358:Myom2 UTSW 8 15,162,018 (GRCm39) missense possibly damaging 0.68
R2904:Myom2 UTSW 8 15,148,348 (GRCm39) missense probably benign 0.00
R3418:Myom2 UTSW 8 15,135,294 (GRCm39) missense probably benign 0.01
R3606:Myom2 UTSW 8 15,119,775 (GRCm39) missense probably damaging 1.00
R3607:Myom2 UTSW 8 15,119,775 (GRCm39) missense probably damaging 1.00
R3735:Myom2 UTSW 8 15,119,676 (GRCm39) missense probably benign 0.01
R3756:Myom2 UTSW 8 15,152,650 (GRCm39) missense probably benign 0.11
R3902:Myom2 UTSW 8 15,154,165 (GRCm39) missense probably benign
R3951:Myom2 UTSW 8 15,134,556 (GRCm39) missense probably benign 0.35
R4240:Myom2 UTSW 8 15,182,895 (GRCm39) missense probably benign 0.10
R4361:Myom2 UTSW 8 15,162,018 (GRCm39) missense possibly damaging 0.68
R4581:Myom2 UTSW 8 15,156,459 (GRCm39) missense probably benign 0.02
R4736:Myom2 UTSW 8 15,131,271 (GRCm39) missense probably damaging 0.99
R5010:Myom2 UTSW 8 15,133,310 (GRCm39) missense probably damaging 0.98
R5108:Myom2 UTSW 8 15,182,667 (GRCm39) missense probably damaging 0.99
R5370:Myom2 UTSW 8 15,149,343 (GRCm39) missense probably benign 0.10
R5427:Myom2 UTSW 8 15,163,764 (GRCm39) missense probably benign 0.03
R5498:Myom2 UTSW 8 15,179,142 (GRCm39) missense probably benign 0.01
R5504:Myom2 UTSW 8 15,178,879 (GRCm39) missense probably damaging 1.00
R5567:Myom2 UTSW 8 15,152,546 (GRCm39) missense probably benign 0.01
R5743:Myom2 UTSW 8 15,130,914 (GRCm39) missense possibly damaging 0.82
R5745:Myom2 UTSW 8 15,172,705 (GRCm39) missense probably benign 0.01
R5844:Myom2 UTSW 8 15,181,182 (GRCm39) critical splice donor site probably null
R5854:Myom2 UTSW 8 15,158,478 (GRCm39) missense probably benign
R6141:Myom2 UTSW 8 15,113,903 (GRCm39) missense probably damaging 1.00
R6209:Myom2 UTSW 8 15,154,173 (GRCm39) missense possibly damaging 0.76
R6248:Myom2 UTSW 8 15,148,472 (GRCm39) splice site probably null
R6378:Myom2 UTSW 8 15,149,356 (GRCm39) missense probably benign 0.11
R6829:Myom2 UTSW 8 15,172,643 (GRCm39) nonsense probably null
R6913:Myom2 UTSW 8 15,115,710 (GRCm39) missense probably benign
R6957:Myom2 UTSW 8 15,167,741 (GRCm39) missense probably null 0.42
R6958:Myom2 UTSW 8 15,167,741 (GRCm39) missense probably null 0.42
R6960:Myom2 UTSW 8 15,167,741 (GRCm39) missense probably null 0.42
R6961:Myom2 UTSW 8 15,167,741 (GRCm39) missense probably null 0.42
R6962:Myom2 UTSW 8 15,167,741 (GRCm39) missense probably null 0.42
R6999:Myom2 UTSW 8 15,134,531 (GRCm39) missense probably benign 0.22
R7148:Myom2 UTSW 8 15,134,577 (GRCm39) missense possibly damaging 0.72
R7210:Myom2 UTSW 8 15,154,114 (GRCm39) missense probably damaging 1.00
R7298:Myom2 UTSW 8 15,148,411 (GRCm39) missense probably damaging 1.00
R7463:Myom2 UTSW 8 15,167,679 (GRCm39) missense probably null 0.94
R7535:Myom2 UTSW 8 15,167,679 (GRCm39) missense probably damaging 1.00
R7573:Myom2 UTSW 8 15,172,450 (GRCm39) missense probably damaging 1.00
R7590:Myom2 UTSW 8 15,167,679 (GRCm39) missense probably damaging 1.00
R7690:Myom2 UTSW 8 15,161,717 (GRCm39) critical splice acceptor site probably null
R7794:Myom2 UTSW 8 15,133,259 (GRCm39) missense probably damaging 1.00
R7822:Myom2 UTSW 8 15,158,454 (GRCm39) missense probably benign
R7948:Myom2 UTSW 8 15,135,306 (GRCm39) missense probably benign 0.00
R8094:Myom2 UTSW 8 15,119,418 (GRCm39) missense possibly damaging 0.94
R8268:Myom2 UTSW 8 15,179,157 (GRCm39) missense probably damaging 1.00
R8292:Myom2 UTSW 8 15,182,888 (GRCm39) missense probably benign 0.01
R8514:Myom2 UTSW 8 15,175,153 (GRCm39) missense possibly damaging 0.65
R8539:Myom2 UTSW 8 15,164,254 (GRCm39) missense probably benign 0.01
R8790:Myom2 UTSW 8 15,169,242 (GRCm39) missense probably damaging 1.00
R8824:Myom2 UTSW 8 15,164,169 (GRCm39) missense possibly damaging 0.82
R8895:Myom2 UTSW 8 15,152,589 (GRCm39) nonsense probably null
R9024:Myom2 UTSW 8 15,113,936 (GRCm39) missense probably damaging 1.00
R9129:Myom2 UTSW 8 15,154,068 (GRCm39) missense probably damaging 1.00
R9224:Myom2 UTSW 8 15,178,804 (GRCm39) missense possibly damaging 0.89
R9237:Myom2 UTSW 8 15,152,591 (GRCm39) missense possibly damaging 0.85
R9321:Myom2 UTSW 8 15,172,464 (GRCm39) missense possibly damaging 0.91
R9341:Myom2 UTSW 8 15,134,633 (GRCm39) missense probably damaging 0.97
R9343:Myom2 UTSW 8 15,134,633 (GRCm39) missense probably damaging 0.97
R9375:Myom2 UTSW 8 15,149,210 (GRCm39) missense probably damaging 1.00
R9455:Myom2 UTSW 8 15,156,293 (GRCm39) missense probably benign 0.31
R9563:Myom2 UTSW 8 15,158,399 (GRCm39) nonsense probably null
R9565:Myom2 UTSW 8 15,158,399 (GRCm39) nonsense probably null
RF001:Myom2 UTSW 8 15,131,418 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TGAGTCCTTCGACCTGCTAC -3'
(R):5'- GACCTTGCCTTTACCTGCAG -3'

Sequencing Primer
(F):5'- CCTGCTACAAAGAACTGAATGTG -3'
(R):5'- TTTACCTGCAGGAGTCCCTAGAAG -3'
Posted On 2014-08-25