Mutagenetix > Incidental Mutation

Incidental Mutation 'R2045:Lcp1'

221874

Institutional Source

Beutler Lab

Gene Symbol

Lcp1

Ensembl Gene

ENSMUSG00000021998

Gene Name

lymphocyte cytosolic protein 1

Synonyms

D14Ertd310e, L-fimbrin, Pls2, L-plastin

MMRRC Submission

040052-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2045 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75131101-75230842 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 75200401 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 84 (T84S)

Ref Sequence

ENSEMBL: ENSMUSP00000117984 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000122840] [ENSMUST00000124499] [ENSMUST00000125833] [ENSMUST00000131802] [ENSMUST00000134114] [ENSMUST00000143539] [ENSMUST00000145303]

AlphaFold

Q61233

Predicted Effect

probably benign
Transcript: ENSMUST00000122840
AA Change: T84S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000117984
Gene: ENSMUSG00000021998
AA Change: T84S

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124499
AA Change: T84S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000121201
Gene: ENSMUSG00000021998
AA Change: T84S

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART
CH	122	234	1.15e-24	SMART
CH	266	373	1.51e-19	SMART
CH	396	501	1.87e-24	SMART
CH	517	622	8.55e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125833
AA Change: T84S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000116033
Gene: ENSMUSG00000021998
AA Change: T84S

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130510

Predicted Effect

probably benign
Transcript: ENSMUST00000131802
AA Change: T84S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000117137
Gene: ENSMUSG00000021998
AA Change: T84S

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART
CH	122	234	1.15e-24	SMART
CH	266	373	1.51e-19	SMART
CH	396	501	1.87e-24	SMART
CH	517	622	8.55e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000134114
AA Change: T84S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000121376
Gene: ENSMUSG00000021998
AA Change: T84S

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000143539

SMART Domains

Protein: ENSMUSP00000118721
Gene: ENSMUSG00000021998

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	76	4.45e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000145303
AA Change: T84S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000116271
Gene: ENSMUSG00000021998
AA Change: T84S

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART
CH	122	234	1.15e-24	SMART
CH	266	373	1.51e-19	SMART
CH	396	501	1.87e-24	SMART
CH	517	622	8.55e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149883

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161819

Meta Mutation Damage Score

0.0592

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.6%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). However, L-plastin has been found in many types of malignant human cells of non-hemopoietic origin suggesting that its expression is induced accompanying tumorigenesis in solid tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to S. aureus infection, defective neutrophil killing of S. aureus, and impaired adhesion-dependent respiratory bursts in neutrophils. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acta2	C	T	19: 34,243,399	G303E	probably damaging	Het
Adamts1	A	T	16: 85,795,976	Y515N	probably damaging	Het
Ankef1	T	C	2: 136,554,738	V695A	probably benign	Het
Ankrd63	C	A	2: 118,703,353		probably benign	Het
Asah2	A	T	19: 32,052,956	N105K	probably benign	Het
Atf2	A	C	2: 73,863,208	D3E	probably damaging	Het
Atp5f1	T	C	3: 105,943,874		probably benign	Het
Bag4	C	T	8: 25,769,488	A228T	probably benign	Het
Bms1	A	C	6: 118,392,627	L960W	probably damaging	Het
Cacna1c	A	G	6: 118,656,137	V977A	probably damaging	Het
Cadps2	A	G	6: 23,839,122	S6P	possibly damaging	Het
Capn8	A	G	1: 182,613,386	T462A	probably benign	Het
Cd226	T	C	18: 89,207,362	S128P	probably benign	Het
Cd33	G	T	7: 43,529,892	H278N	probably benign	Het
Cdh1	T	C	8: 106,666,182		probably benign	Het
Cfap54	T	C	10: 93,038,809		probably null	Het
Chit1	A	G	1: 134,151,144	I397M	probably benign	Het
Cic	C	A	7: 25,271,536	Q231K	possibly damaging	Het
Clca4b	A	G	3: 144,925,163	V312A	probably damaging	Het
Cngb1	T	A	8: 95,297,085		probably null	Het
Cyfip2	T	C	11: 46,249,789	I430V	probably benign	Het
Dnah12	A	G	14: 26,781,528	E1613G	probably null	Het
Dock2	T	C	11: 34,294,106		probably null	Het
Dync2h1	A	T	9: 7,160,171	F646I	probably damaging	Het
Eef1b2	A	T	1: 63,179,487	K144*	probably null	Het
Erap1	T	C	13: 74,669,450	V137A	probably benign	Het
Fam196a	T	G	7: 134,918,430	K124Q	probably damaging	Het
Far1	A	T	7: 113,539,271		probably null	Het
Fbn2	A	T	18: 58,090,658	C807S	probably damaging	Het
Fgfr1	A	G	8: 25,558,215	K209R	probably benign	Het
Fpr-rs4	CAGGAA	CA	17: 18,022,334		probably null	Het
Frem2	A	T	3: 53,535,744	V2533D	probably damaging	Het
Hip1r	T	C	5: 124,000,731	M839T	probably benign	Het
Igfbp2	A	G	1: 72,852,151	S303G	probably benign	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Itgb3	T	G	11: 104,623,413	S27A	probably benign	Het
Kif21b	G	A	1: 136,160,313	D1015N	probably damaging	Het
Krt7	A	T	15: 101,423,484		probably null	Het
Krtdap	T	A	7: 30,790,585	F80L	probably benign	Het
Lipi	G	A	16: 75,550,199	T444I	probably damaging	Het
Lrguk	A	T	6: 34,071,068	E316V	probably damaging	Het
Lypd1	G	A	1: 125,910,535		probably benign	Het
Med12l	A	T	3: 59,262,310	K1632*	probably null	Het
Mrgpra9	A	T	7: 47,235,835	M28K	probably benign	Het
Mylk	A	G	16: 34,953,653	K1291E	probably benign	Het
Nek4	T	A	14: 30,953,923	W72R	probably damaging	Het
Nudt8	T	C	19: 4,001,899	V170A	probably damaging	Het
Oosp3	T	A	19: 11,699,369	Y31N	probably benign	Het
Padi2	A	T	4: 140,937,930	R449W	probably damaging	Het
Pcf11	G	T	7: 92,661,879	N300K	probably damaging	Het
Pcsk5	T	C	19: 17,581,144	D633G	possibly damaging	Het
Phlpp2	T	A	8: 109,907,600	W271R	probably damaging	Het
Pikfyve	T	C	1: 65,253,353	V1276A	probably benign	Het
Pkhd1l1	A	T	15: 44,479,654	N176Y	probably damaging	Het
Pop5	T	G	5: 115,238,212	V33G	possibly damaging	Het
Prkag2	A	G	5: 24,947,582	F175L	possibly damaging	Het
Ptpn22	T	A	3: 103,874,021	D79E	possibly damaging	Het
Rab32	T	G	10: 10,550,833	D123A	probably damaging	Het
Rnpc3	T	C	3: 113,608,360	K513E	possibly damaging	Het
Senp1	A	T	15: 98,059,944	F358I	possibly damaging	Het
Sft2d2	A	G	1: 165,185,078	L83P	probably damaging	Het
Slc9c1	G	A	16: 45,580,250	R741H	probably damaging	Het
Smad4	A	T	18: 73,649,806	Y352*	probably null	Het
Tamm41	T	A	6: 115,016,095	Q232H	probably benign	Het
Tbx6	T	A	7: 126,782,883	L131Q	probably damaging	Het
Trappc10	T	C	10: 78,209,479		probably benign	Het
Trp53bp1	C	A	2: 121,204,483	A108S	probably benign	Het
Unc13b	G	A	4: 43,091,266	V31M	probably damaging	Het
Usp24	T	C	4: 106,400,980	M1525T	possibly damaging	Het
Vax2	G	A	6: 83,711,270		probably benign	Het
Vcan	T	A	13: 89,690,985	I2147L	probably benign	Het
Zbtb7a	C	A	10: 81,144,410	A146E	probably benign	Het
Zcchc6	T	C	13: 59,800,656	Y215C	probably damaging	Het
Zfp287	A	G	11: 62,727,569	L157P	probably damaging	Het

Other mutations in Lcp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01103:Lcp1	APN	14	75227093	critical splice donor site	probably null
IGL01768:Lcp1	APN	14	75224133	missense	probably benign	0.40
IGL01801:Lcp1	APN	14	75199375	missense	probably benign	0.10
IGL01940:Lcp1	APN	14	75216365	missense	probably benign	0.17
IGL02135:Lcp1	APN	14	75200486	missense	probably benign	0.00
IGL02185:Lcp1	APN	14	75229300	missense	possibly damaging	0.73
IGL02478:Lcp1	APN	14	75224096	missense	probably benign	0.04
IGL02604:Lcp1	APN	14	75224126	missense	probably benign	0.11
R0244:Lcp1	UTSW	14	75227001	missense	possibly damaging	0.92
R0295:Lcp1	UTSW	14	75199420	missense	probably null	0.59
R0313:Lcp1	UTSW	14	75199433	missense	probably damaging	1.00
R0415:Lcp1	UTSW	14	75227006	missense	possibly damaging	0.88
R0751:Lcp1	UTSW	14	75199387	missense	probably benign	0.00
R0811:Lcp1	UTSW	14	75214488	missense	probably benign	0.00
R0812:Lcp1	UTSW	14	75214488	missense	probably benign	0.00
R1200:Lcp1	UTSW	14	75229302	missense	possibly damaging	0.73
R1713:Lcp1	UTSW	14	75199444	critical splice donor site	probably null
R1915:Lcp1	UTSW	14	75199297	missense	possibly damaging	0.81
R1969:Lcp1	UTSW	14	75200506	missense	probably damaging	1.00
R1970:Lcp1	UTSW	14	75200506	missense	probably damaging	1.00
R1971:Lcp1	UTSW	14	75200506	missense	probably damaging	1.00
R2064:Lcp1	UTSW	14	75198075	critical splice acceptor site	probably null
R3949:Lcp1	UTSW	14	75206129	missense	possibly damaging	0.68
R4062:Lcp1	UTSW	14	75215180	missense	probably damaging	1.00
R4521:Lcp1	UTSW	14	75215168	missense	possibly damaging	0.94
R4811:Lcp1	UTSW	14	75200408	missense	probably damaging	0.99
R4854:Lcp1	UTSW	14	75200489	missense	probably damaging	1.00
R4974:Lcp1	UTSW	14	75208471	nonsense	probably null
R5539:Lcp1	UTSW	14	75229298	missense	probably benign	0.08
R5561:Lcp1	UTSW	14	75212508	missense	probably benign	0.01
R5724:Lcp1	UTSW	14	75226982	missense	probably benign	0.18
R5989:Lcp1	UTSW	14	75199387	missense	probably benign	0.00
R6731:Lcp1	UTSW	14	75206189	missense	probably damaging	1.00
R7346:Lcp1	UTSW	14	75210506	missense	possibly damaging	0.49
R7670:Lcp1	UTSW	14	75200431	missense	probably benign	0.12
R7698:Lcp1	UTSW	14	75206211	nonsense	probably null
R9780:Lcp1	UTSW	14	75202738	missense	probably damaging	1.00
S24628:Lcp1	UTSW	14	75227006	missense	possibly damaging	0.88
X0027:Lcp1	UTSW	14	75227086	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAAGGCAAGAGGATTTGGGGTT -3'
(R):5'- ACAGCTGGGTCCTTCCTCC -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- CCTCACTGTATCCTTTGCCAG -3'

Posted On

2014-08-25