Incidental Mutation 'R1977:Pnpt1'
ID221892
Institutional Source Beutler Lab
Gene Symbol Pnpt1
Ensembl Gene ENSMUSG00000020464
Gene Namepolyribonucleotide nucleotidyltransferase 1
SynonymsPNPase, polynucleotide phosphorylase, 1200003F12Rik
MMRRC Submission 039990-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1977 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location29130744-29161828 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29141256 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 337 (I337V)
Ref Sequence ENSEMBL: ENSMUSP00000020756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020756]
PDB Structure
Solution structure of the alpha-helical domain from mouse hypothetical PNPase [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000020756
AA Change: I337V

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020756
Gene: ENSMUSG00000020464
AA Change: I337V

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
Pfam:RNase_PH 52 183 1.9e-16 PFAM
Pfam:RNase_PH_C 186 251 3.8e-13 PFAM
Pfam:PNPase 282 363 3.7e-9 PFAM
Pfam:RNase_PH 366 501 3.4e-22 PFAM
Pfam:RNase_PH_C 504 581 7.1e-6 PFAM
KH 604 669 8e-7 SMART
S1 677 750 2.15e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154924
Meta Mutation Damage Score 0.0845 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the evolutionary conserved polynucleotide phosphorylase family comprised of phosphate dependent 3'-to-5' exoribonucleases implicated in RNA processing and degradation. This enzyme is predominantly localized in the mitochondrial intermembrane space and is involved in import of RNA to mitochondria. Mutations in this gene have been associated with combined oxidative phosphorylation deficiency-13 and autosomal recessive nonsyndromic deafness-70. Related pseudogenes are found on chromosomes 3 and 7. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality and impaired mitochondrial RNA import. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf3 G T 8: 122,781,533 C256F probably damaging Het
Adgra2 T A 8: 27,115,761 V647D possibly damaging Het
AI593442 A T 9: 52,678,192 S28R probably damaging Het
Akr1c21 G C 13: 4,574,212 G22R probably damaging Het
Ampd3 T C 7: 110,803,162 W458R probably damaging Het
Arhgap23 G T 11: 97,451,447 R185L possibly damaging Het
Arhgap45 A T 10: 80,020,818 I67F probably damaging Het
Asah1 A G 8: 41,343,517 probably null Het
Atl2 A G 17: 79,852,590 Y56H probably damaging Het
Carf A T 1: 60,146,136 I447F probably damaging Het
Crmp1 A G 5: 37,276,283 N162S probably damaging Het
Cyp2a5 A G 7: 26,835,922 E103G probably benign Het
Cyp2c40 T C 19: 39,778,041 D370G probably damaging Het
Dhrs2 T A 14: 55,234,655 M1K probably null Het
Dnah17 T C 11: 118,112,591 E810G possibly damaging Het
E2f5 T A 3: 14,587,356 I84N probably damaging Het
Eif2ak4 A T 2: 118,461,757 K1185* probably null Het
Eif4ebp1 T A 8: 27,275,101 M115K probably damaging Het
Evi5 A T 5: 107,799,139 L505* probably null Het
Fbxw25 T A 9: 109,652,856 Y254F possibly damaging Het
Gm7964 T A 7: 83,757,352 F439Y possibly damaging Het
Gps1 A G 11: 120,785,826 T124A probably damaging Het
Hopx T C 5: 77,117,616 probably benign Het
Hoxd3 A G 2: 74,744,276 S89G possibly damaging Het
Hrc A T 7: 45,336,214 D263V probably damaging Het
Hs6st3 T C 14: 119,138,476 I21T probably benign Het
Izumo4 A G 10: 80,703,121 Y106C probably damaging Het
Lama2 A T 10: 26,990,800 probably null Het
Lcorl A C 5: 45,775,420 S123R probably null Het
Lgr4 A T 2: 110,011,928 I729F probably damaging Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Matn3 T A 12: 8,961,110 probably benign Het
Mdc1 T A 17: 35,850,930 S912T probably benign Het
Mgam G A 6: 40,664,880 V556I probably benign Het
Myom2 A T 8: 15,085,263 I489F possibly damaging Het
Nfatc2 G A 2: 168,504,459 T905I possibly damaging Het
Nme6 G A 9: 109,835,341 R6Q probably damaging Het
Nr1h5 A G 3: 102,947,817 S323P probably damaging Het
Nr4a3 C A 4: 48,056,539 R364S probably damaging Het
Obox7 A T 7: 14,664,398 D79V probably damaging Het
Olfr167 G A 16: 19,514,836 P267S probably damaging Het
Olfr374 G A 8: 72,109,854 G96D probably benign Het
Olfr435 T A 6: 43,201,980 V112D possibly damaging Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Parp8 T A 13: 116,910,913 I208F probably damaging Het
Pdgfc C T 3: 81,209,245 T302I probably damaging Het
Polk T C 13: 96,489,228 E436G probably damaging Het
Pramel7 A G 2: 87,491,121 V190A probably benign Het
Rplp2 T C 7: 141,448,781 probably benign Het
Sec23ip T A 7: 128,766,273 S670T probably damaging Het
Sgk2 A G 2: 163,004,160 N207S probably benign Het
Sh2d2a C T 3: 87,851,816 Q242* probably null Het
Sh3pxd2b A C 11: 32,422,138 N435T probably damaging Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Stx17 G A 4: 48,181,553 V241M probably benign Het
Taok3 A T 5: 117,265,924 K721N probably damaging Het
Tbxas1 A G 6: 38,948,641 probably benign Het
Tmem87a G A 2: 120,374,504 A377V probably benign Het
Topaz1 C T 9: 122,747,362 T6M unknown Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Vmn2r125 A G 4: 156,354,591 probably null Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Wdr59 A T 8: 111,458,638 C888S probably benign Het
Other mutations in Pnpt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Pnpt1 APN 11 29154217 critical splice donor site probably null
IGL00920:Pnpt1 APN 11 29157087 splice site probably benign
IGL01358:Pnpt1 APN 11 29138425 missense possibly damaging 0.95
IGL01454:Pnpt1 APN 11 29137142 missense probably benign 0.19
IGL01622:Pnpt1 APN 11 29148272 splice site probably benign
IGL01623:Pnpt1 APN 11 29148272 splice site probably benign
IGL01674:Pnpt1 APN 11 29155787 missense probably benign 0.00
IGL01802:Pnpt1 APN 11 29154306 missense probably damaging 1.00
IGL02222:Pnpt1 APN 11 29159327 missense possibly damaging 0.71
IGL02222:Pnpt1 APN 11 29130842 missense probably benign 0.00
IGL02616:Pnpt1 APN 11 29135505 splice site probably benign
IGL02859:Pnpt1 APN 11 29138162 missense probably damaging 1.00
IGL02965:Pnpt1 APN 11 29156939 missense probably damaging 0.98
IGL03121:Pnpt1 APN 11 29132845 missense probably benign 0.03
PIT4651001:Pnpt1 UTSW 11 29156945 critical splice donor site probably null
R1023:Pnpt1 UTSW 11 29141328 splice site probably benign
R1477:Pnpt1 UTSW 11 29137102 missense probably benign 0.14
R1524:Pnpt1 UTSW 11 29130776 missense unknown
R1769:Pnpt1 UTSW 11 29154159 missense probably benign 0.22
R1839:Pnpt1 UTSW 11 29154342 missense possibly damaging 0.82
R1975:Pnpt1 UTSW 11 29141256 missense probably benign 0.16
R1996:Pnpt1 UTSW 11 29141679 missense probably benign 0.01
R3771:Pnpt1 UTSW 11 29138174 missense probably benign 0.05
R4346:Pnpt1 UTSW 11 29145478 missense probably damaging 1.00
R4423:Pnpt1 UTSW 11 29153375 splice site probably null
R5354:Pnpt1 UTSW 11 29154166 missense probably damaging 1.00
R5503:Pnpt1 UTSW 11 29138156 missense probably damaging 1.00
R5514:Pnpt1 UTSW 11 29153246 missense possibly damaging 0.82
R5908:Pnpt1 UTSW 11 29130887 missense probably benign 0.00
R6225:Pnpt1 UTSW 11 29145469 missense probably benign 0.38
R6605:Pnpt1 UTSW 11 29138567 missense possibly damaging 0.69
R7096:Pnpt1 UTSW 11 29154867 missense probably benign 0.03
R7214:Pnpt1 UTSW 11 29137285 missense probably damaging 1.00
R7365:Pnpt1 UTSW 11 29161334 missense probably damaging 1.00
R7492:Pnpt1 UTSW 11 29135522 missense probably benign 0.01
R7497:Pnpt1 UTSW 11 29130860 missense probably benign 0.00
R7686:Pnpt1 UTSW 11 29157070 missense probably damaging 0.97
R8166:Pnpt1 UTSW 11 29156875 missense probably benign
R8309:Pnpt1 UTSW 11 29153277 missense probably benign 0.01
R8389:Pnpt1 UTSW 11 29130758 start codon destroyed unknown
Z1176:Pnpt1 UTSW 11 29145475 missense probably benign 0.00
Z1176:Pnpt1 UTSW 11 29145477 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GCCAAATGCCTATAACTGCC -3'
(R):5'- CTTGCCAATAGGTGCTCATTTAC -3'

Sequencing Primer
(F):5'- GCCAAATGCCTATAACTGCCTTAAG -3'
(R):5'- CTTCACTTTGACCACAGG -3'
Posted On2014-08-25