Incidental Mutation 'R1977:Arhgap23'
ID221896
Institutional Source Beutler Lab
Gene Symbol Arhgap23
Ensembl Gene ENSMUSG00000049807
Gene NameRho GTPase activating protein 23
Synonyms
MMRRC Submission 039990-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1977 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location97415533-97502402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 97451447 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 185 (R185L)
Ref Sequence ENSEMBL: ENSMUSP00000112999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107601] [ENSMUST00000121799] [ENSMUST00000142465]
Predicted Effect probably benign
Transcript: ENSMUST00000107601
SMART Domains Protein: ENSMUSP00000103227
Gene: ENSMUSG00000049807

DomainStartEndE-ValueType
low complexity region 246 258 N/A INTRINSIC
low complexity region 354 369 N/A INTRINSIC
low complexity region 426 443 N/A INTRINSIC
PH 479 600 3.2e-12 SMART
low complexity region 679 687 N/A INTRINSIC
RhoGAP 707 884 6.83e-65 SMART
low complexity region 1051 1066 N/A INTRINSIC
low complexity region 1101 1114 N/A INTRINSIC
low complexity region 1125 1146 N/A INTRINSIC
low complexity region 1176 1194 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121799
AA Change: R185L

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112999
Gene: ENSMUSG00000049807
AA Change: R185L

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
PDZ 52 160 4.2e-17 SMART
low complexity region 457 469 N/A INTRINSIC
low complexity region 565 580 N/A INTRINSIC
low complexity region 637 654 N/A INTRINSIC
PH 690 811 3.2e-12 SMART
low complexity region 890 898 N/A INTRINSIC
RhoGAP 918 1095 6.83e-65 SMART
low complexity region 1262 1277 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
low complexity region 1336 1357 N/A INTRINSIC
low complexity region 1387 1405 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142465
SMART Domains Protein: ENSMUSP00000123191
Gene: ENSMUSG00000049807

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
low complexity region 126 143 N/A INTRINSIC
PH 179 300 3.2e-12 SMART
low complexity region 379 387 N/A INTRINSIC
RhoGAP 407 584 6.83e-65 SMART
Meta Mutation Damage Score 0.0754 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RHO (see ARHA; MIM 165390) family of small GTPases are involved in signal transduction through transmembrane receptors, and they are inactive in the GDP-bound form and active in the GTP-bound form. GTPase-activating proteins, such as ARHGAP23, inactivate RHO family proteins by stimulating their hydrolysis of GTP (Katoh and Katoh, 2004 [PubMed 15254754]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf3 G T 8: 122,781,533 C256F probably damaging Het
Adgra2 T A 8: 27,115,761 V647D possibly damaging Het
AI593442 A T 9: 52,678,192 S28R probably damaging Het
Akr1c21 G C 13: 4,574,212 G22R probably damaging Het
Ampd3 T C 7: 110,803,162 W458R probably damaging Het
Arhgap45 A T 10: 80,020,818 I67F probably damaging Het
Asah1 A G 8: 41,343,517 probably null Het
Atl2 A G 17: 79,852,590 Y56H probably damaging Het
Carf A T 1: 60,146,136 I447F probably damaging Het
Crmp1 A G 5: 37,276,283 N162S probably damaging Het
Cyp2a5 A G 7: 26,835,922 E103G probably benign Het
Cyp2c40 T C 19: 39,778,041 D370G probably damaging Het
Dhrs2 T A 14: 55,234,655 M1K probably null Het
Dnah17 T C 11: 118,112,591 E810G possibly damaging Het
E2f5 T A 3: 14,587,356 I84N probably damaging Het
Eif2ak4 A T 2: 118,461,757 K1185* probably null Het
Eif4ebp1 T A 8: 27,275,101 M115K probably damaging Het
Evi5 A T 5: 107,799,139 L505* probably null Het
Fbxw25 T A 9: 109,652,856 Y254F possibly damaging Het
Gm7964 T A 7: 83,757,352 F439Y possibly damaging Het
Gps1 A G 11: 120,785,826 T124A probably damaging Het
Hopx T C 5: 77,117,616 probably benign Het
Hoxd3 A G 2: 74,744,276 S89G possibly damaging Het
Hrc A T 7: 45,336,214 D263V probably damaging Het
Hs6st3 T C 14: 119,138,476 I21T probably benign Het
Izumo4 A G 10: 80,703,121 Y106C probably damaging Het
Lama2 A T 10: 26,990,800 probably null Het
Lcorl A C 5: 45,775,420 S123R probably null Het
Lgr4 A T 2: 110,011,928 I729F probably damaging Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Matn3 T A 12: 8,961,110 probably benign Het
Mdc1 T A 17: 35,850,930 S912T probably benign Het
Mgam G A 6: 40,664,880 V556I probably benign Het
Myom2 A T 8: 15,085,263 I489F possibly damaging Het
Nfatc2 G A 2: 168,504,459 T905I possibly damaging Het
Nme6 G A 9: 109,835,341 R6Q probably damaging Het
Nr1h5 A G 3: 102,947,817 S323P probably damaging Het
Nr4a3 C A 4: 48,056,539 R364S probably damaging Het
Obox7 A T 7: 14,664,398 D79V probably damaging Het
Olfr167 G A 16: 19,514,836 P267S probably damaging Het
Olfr374 G A 8: 72,109,854 G96D probably benign Het
Olfr435 T A 6: 43,201,980 V112D possibly damaging Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Parp8 T A 13: 116,910,913 I208F probably damaging Het
Pdgfc C T 3: 81,209,245 T302I probably damaging Het
Pnpt1 A G 11: 29,141,256 I337V probably benign Het
Polk T C 13: 96,489,228 E436G probably damaging Het
Pramel7 A G 2: 87,491,121 V190A probably benign Het
Rplp2 T C 7: 141,448,781 probably benign Het
Sec23ip T A 7: 128,766,273 S670T probably damaging Het
Sgk2 A G 2: 163,004,160 N207S probably benign Het
Sh2d2a C T 3: 87,851,816 Q242* probably null Het
Sh3pxd2b A C 11: 32,422,138 N435T probably damaging Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Stx17 G A 4: 48,181,553 V241M probably benign Het
Taok3 A T 5: 117,265,924 K721N probably damaging Het
Tbxas1 A G 6: 38,948,641 probably benign Het
Tmem87a G A 2: 120,374,504 A377V probably benign Het
Topaz1 C T 9: 122,747,362 T6M unknown Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Vmn2r125 A G 4: 156,354,591 probably null Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Wdr59 A T 8: 111,458,638 C888S probably benign Het
Other mutations in Arhgap23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Arhgap23 APN 11 97492671 intron probably benign
IGL00493:Arhgap23 APN 11 97446553 critical splice donor site probably null
IGL01729:Arhgap23 APN 11 97453961 missense probably damaging 1.00
IGL01805:Arhgap23 APN 11 97492602 intron probably benign
IGL02005:Arhgap23 APN 11 97491219 missense probably damaging 0.99
IGL02026:Arhgap23 APN 11 97451581 missense probably damaging 0.99
IGL02135:Arhgap23 APN 11 97451702 missense probably damaging 0.97
IGL02178:Arhgap23 APN 11 97452353 missense probably benign 0.42
IGL02226:Arhgap23 APN 11 97451600 missense probably benign 0.07
IGL02309:Arhgap23 APN 11 97466001 splice site probably benign
IGL02399:Arhgap23 APN 11 97491005 intron probably benign
IGL02630:Arhgap23 APN 11 97454297 missense probably benign 0.24
IGL02724:Arhgap23 APN 11 97491179 missense probably damaging 0.99
IGL02740:Arhgap23 APN 11 97475017 missense probably damaging 1.00
IGL02746:Arhgap23 APN 11 97454204 splice site probably benign
IGL02862:Arhgap23 APN 11 97456480 missense probably damaging 1.00
IGL03380:Arhgap23 APN 11 97452518 missense probably damaging 1.00
R0091:Arhgap23 UTSW 11 97452244 missense probably benign 0.44
R0134:Arhgap23 UTSW 11 97444328 missense probably benign 0.09
R0225:Arhgap23 UTSW 11 97444328 missense probably benign 0.09
R0305:Arhgap23 UTSW 11 97501109 missense probably damaging 0.99
R0358:Arhgap23 UTSW 11 97463588 missense probably damaging 1.00
R0422:Arhgap23 UTSW 11 97463652 missense probably damaging 1.00
R0497:Arhgap23 UTSW 11 97452163 missense probably damaging 1.00
R0580:Arhgap23 UTSW 11 97446536 frame shift probably null
R0782:Arhgap23 UTSW 11 97500554 missense possibly damaging 0.73
R1216:Arhgap23 UTSW 11 97492672 intron probably benign
R1488:Arhgap23 UTSW 11 97500859 missense possibly damaging 0.53
R1785:Arhgap23 UTSW 11 97451561 missense possibly damaging 0.77
R1844:Arhgap23 UTSW 11 97463408 missense probably damaging 1.00
R1855:Arhgap23 UTSW 11 97448697 missense probably damaging 0.99
R2064:Arhgap23 UTSW 11 97493062 missense probably benign 0.02
R2130:Arhgap23 UTSW 11 97451561 missense possibly damaging 0.77
R2431:Arhgap23 UTSW 11 97452404 missense probably benign
R2853:Arhgap23 UTSW 11 97492594 splice site probably null
R3767:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3768:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3769:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3770:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R4209:Arhgap23 UTSW 11 97454496 missense probably damaging 0.99
R4247:Arhgap23 UTSW 11 97463699 missense probably damaging 1.00
R4997:Arhgap23 UTSW 11 97452020 missense probably damaging 0.98
R5399:Arhgap23 UTSW 11 97500917 missense probably damaging 0.97
R5549:Arhgap23 UTSW 11 97466568 missense probably damaging 0.96
R5655:Arhgap23 UTSW 11 97452546 critical splice donor site probably null
R5857:Arhgap23 UTSW 11 97451579 missense possibly damaging 0.93
R6013:Arhgap23 UTSW 11 97500992 missense probably damaging 0.99
R6031:Arhgap23 UTSW 11 97476139 missense probably damaging 1.00
R6031:Arhgap23 UTSW 11 97476139 missense probably damaging 1.00
R6077:Arhgap23 UTSW 11 97491232 critical splice donor site probably null
R6151:Arhgap23 UTSW 11 97500412 missense probably benign 0.01
R6393:Arhgap23 UTSW 11 97463672 missense probably damaging 0.98
R6693:Arhgap23 UTSW 11 97466517 missense probably damaging 1.00
R6752:Arhgap23 UTSW 11 97452248 missense probably damaging 0.98
R7202:Arhgap23 UTSW 11 97451993 missense possibly damaging 0.65
R7209:Arhgap23 UTSW 11 97476085 missense probably damaging 1.00
R7209:Arhgap23 UTSW 11 97492447 splice site probably null
R7320:Arhgap23 UTSW 11 97451545 missense probably benign 0.10
R7345:Arhgap23 UTSW 11 97466478 missense possibly damaging 0.91
R7599:Arhgap23 UTSW 11 97500343 missense probably benign
R8229:Arhgap23 UTSW 11 97453906 missense probably benign 0.36
R8412:Arhgap23 UTSW 11 97466028 missense probably benign 0.02
R8460:Arhgap23 UTSW 11 97452371 missense probably damaging 1.00
R8492:Arhgap23 UTSW 11 97475021 missense probably damaging 1.00
R8525:Arhgap23 UTSW 11 97490084 missense probably damaging 1.00
R8692:Arhgap23 UTSW 11 97454496 missense probably damaging 0.99
R8708:Arhgap23 UTSW 11 97452412 missense probably benign 0.06
R8749:Arhgap23 UTSW 11 97500815 missense probably damaging 0.99
R8882:Arhgap23 UTSW 11 97465123 missense probably benign 0.00
RF020:Arhgap23 UTSW 11 97463561 missense probably damaging 1.00
V8831:Arhgap23 UTSW 11 97456545 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGATGCCCCTACTTAATCAGCTC -3'
(R):5'- TTGGACAGCCAGTGTGACAG -3'

Sequencing Primer
(F):5'- CCCTTGCATTTCCTTGTGAGAAC -3'
(R):5'- TCCCCAAGGAAGAGTTGTCCAG -3'
Posted On2014-08-25