Incidental Mutation 'R2045:Asah2'
ID221903
Institutional Source Beutler Lab
Gene Symbol Asah2
Ensembl Gene ENSMUSG00000024887
Gene NameN-acylsphingosine amidohydrolase 2
Synonymsneutral/alkaline ceramidase
MMRRC Submission 040052-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.368) question?
Stock #R2045 (G1)
Quality Score219
Status Validated
Chromosome19
Chromosomal Location31984654-32061469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32052956 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 105 (N105K)
Ref Sequence ENSEMBL: ENSMUSP00000093830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096119]
Predicted Effect probably benign
Transcript: ENSMUST00000096119
AA Change: N105K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000093830
Gene: ENSMUSG00000024887
AA Change: N105K

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 56 67 N/A INTRINSIC
Pfam:Ceramidase_alk 78 584 1.4e-222 PFAM
Pfam:Ceramidse_alk_C 586 753 8e-50 PFAM
Meta Mutation Damage Score 0.1394 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ceramidases (EC 3.5.1.23), such as ASAH2, catalyze hydrolysis of the N-acyl linkage of ceramide, a second messenger in a variety of cellular events, to produce sphingosine. Sphingosine exerts both mitogenic and apoptosis-inducing activities, and its phosphorylated form functions as an intra- and intercellular second messenger (see MIM 603730) (Mitsutake et al., 2001 [PubMed 11328816]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are defective in the intestinal digestion of dietary ceramide but exhibit a normal life span with no obvious abnormalities or significant alterations in total ceramide levels in major organ tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,399 G303E probably damaging Het
Adamts1 A T 16: 85,795,976 Y515N probably damaging Het
Ankef1 T C 2: 136,554,738 V695A probably benign Het
Ankrd63 C A 2: 118,703,353 probably benign Het
Atf2 A C 2: 73,863,208 D3E probably damaging Het
Atp5f1 T C 3: 105,943,874 probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 A C 6: 118,392,627 L960W probably damaging Het
Cacna1c A G 6: 118,656,137 V977A probably damaging Het
Cadps2 A G 6: 23,839,122 S6P possibly damaging Het
Capn8 A G 1: 182,613,386 T462A probably benign Het
Cd226 T C 18: 89,207,362 S128P probably benign Het
Cd33 G T 7: 43,529,892 H278N probably benign Het
Cdh1 T C 8: 106,666,182 probably benign Het
Cfap54 T C 10: 93,038,809 probably null Het
Chit1 A G 1: 134,151,144 I397M probably benign Het
Cic C A 7: 25,271,536 Q231K possibly damaging Het
Clca4b A G 3: 144,925,163 V312A probably damaging Het
Cngb1 T A 8: 95,297,085 probably null Het
Cyfip2 T C 11: 46,249,789 I430V probably benign Het
Dnah12 A G 14: 26,781,528 E1613G probably null Het
Dock2 T C 11: 34,294,106 probably null Het
Dync2h1 A T 9: 7,160,171 F646I probably damaging Het
Eef1b2 A T 1: 63,179,487 K144* probably null Het
Erap1 T C 13: 74,669,450 V137A probably benign Het
Fam196a T G 7: 134,918,430 K124Q probably damaging Het
Far1 A T 7: 113,539,271 probably null Het
Fbn2 A T 18: 58,090,658 C807S probably damaging Het
Fgfr1 A G 8: 25,558,215 K209R probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Frem2 A T 3: 53,535,744 V2533D probably damaging Het
Hip1r T C 5: 124,000,731 M839T probably benign Het
Igfbp2 A G 1: 72,852,151 S303G probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itgb3 T G 11: 104,623,413 S27A probably benign Het
Kif21b G A 1: 136,160,313 D1015N probably damaging Het
Krt7 A T 15: 101,423,484 probably null Het
Krtdap T A 7: 30,790,585 F80L probably benign Het
Lcp1 A T 14: 75,200,401 T84S probably benign Het
Lipi G A 16: 75,550,199 T444I probably damaging Het
Lrguk A T 6: 34,071,068 E316V probably damaging Het
Lypd1 G A 1: 125,910,535 probably benign Het
Med12l A T 3: 59,262,310 K1632* probably null Het
Mrgpra9 A T 7: 47,235,835 M28K probably benign Het
Mylk A G 16: 34,953,653 K1291E probably benign Het
Nek4 T A 14: 30,953,923 W72R probably damaging Het
Nudt8 T C 19: 4,001,899 V170A probably damaging Het
Oosp3 T A 19: 11,699,369 Y31N probably benign Het
Padi2 A T 4: 140,937,930 R449W probably damaging Het
Pcf11 G T 7: 92,661,879 N300K probably damaging Het
Pcsk5 T C 19: 17,581,144 D633G possibly damaging Het
Phlpp2 T A 8: 109,907,600 W271R probably damaging Het
Pikfyve T C 1: 65,253,353 V1276A probably benign Het
Pkhd1l1 A T 15: 44,479,654 N176Y probably damaging Het
Pop5 T G 5: 115,238,212 V33G possibly damaging Het
Prkag2 A G 5: 24,947,582 F175L possibly damaging Het
Ptpn22 T A 3: 103,874,021 D79E possibly damaging Het
Rab32 T G 10: 10,550,833 D123A probably damaging Het
Rnpc3 T C 3: 113,608,360 K513E possibly damaging Het
Senp1 A T 15: 98,059,944 F358I possibly damaging Het
Sft2d2 A G 1: 165,185,078 L83P probably damaging Het
Slc9c1 G A 16: 45,580,250 R741H probably damaging Het
Smad4 A T 18: 73,649,806 Y352* probably null Het
Tamm41 T A 6: 115,016,095 Q232H probably benign Het
Tbx6 T A 7: 126,782,883 L131Q probably damaging Het
Trappc10 T C 10: 78,209,479 probably benign Het
Trp53bp1 C A 2: 121,204,483 A108S probably benign Het
Unc13b G A 4: 43,091,266 V31M probably damaging Het
Usp24 T C 4: 106,400,980 M1525T possibly damaging Het
Vax2 G A 6: 83,711,270 probably benign Het
Vcan T A 13: 89,690,985 I2147L probably benign Het
Zbtb7a C A 10: 81,144,410 A146E probably benign Het
Zcchc6 T C 13: 59,800,656 Y215C probably damaging Het
Zfp287 A G 11: 62,727,569 L157P probably damaging Het
Other mutations in Asah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Asah2 APN 19 32008681 splice site probably benign
IGL02001:Asah2 APN 19 32043539 nonsense probably null
IGL02228:Asah2 APN 19 32016714 missense probably benign 0.09
IGL02377:Asah2 APN 19 32009414 missense probably benign 0.30
IGL03070:Asah2 APN 19 32006344 missense probably damaging 1.00
IGL03233:Asah2 APN 19 32054631 missense probably benign 0.18
IGL03244:Asah2 APN 19 31986942 missense probably damaging 1.00
R0008:Asah2 UTSW 19 32003731 nonsense probably null
R0103:Asah2 UTSW 19 32018977 missense probably benign 0.01
R0103:Asah2 UTSW 19 32018977 missense probably benign 0.01
R0302:Asah2 UTSW 19 32052956 missense probably benign 0.01
R0497:Asah2 UTSW 19 32054631 missense probably benign 0.18
R0614:Asah2 UTSW 19 32016728 missense probably damaging 1.00
R0639:Asah2 UTSW 19 32008639 missense probably damaging 0.99
R0715:Asah2 UTSW 19 32016776 missense probably damaging 0.97
R1332:Asah2 UTSW 19 32044941 missense probably damaging 1.00
R1336:Asah2 UTSW 19 32044941 missense probably damaging 1.00
R2062:Asah2 UTSW 19 32024874 missense probably damaging 0.99
R4083:Asah2 UTSW 19 31986784 missense probably benign 0.01
R4698:Asah2 UTSW 19 32054471 splice site probably null
R4731:Asah2 UTSW 19 31995358 missense probably benign 0.41
R4732:Asah2 UTSW 19 31995358 missense probably benign 0.41
R4733:Asah2 UTSW 19 31995358 missense probably benign 0.41
R4773:Asah2 UTSW 19 32052858 missense probably damaging 1.00
R4930:Asah2 UTSW 19 32052906 missense probably benign 0.35
R5081:Asah2 UTSW 19 32014308 missense probably benign 0.07
R5741:Asah2 UTSW 19 32008615 missense probably damaging 1.00
R5873:Asah2 UTSW 19 32003682 critical splice donor site probably null
R5905:Asah2 UTSW 19 32016514 missense probably damaging 1.00
R6027:Asah2 UTSW 19 32044951 missense probably benign 0.01
R6028:Asah2 UTSW 19 32016514 missense probably damaging 1.00
R6187:Asah2 UTSW 19 32024867 missense probably damaging 0.99
R6667:Asah2 UTSW 19 31995358 missense probably benign 0.41
R6968:Asah2 UTSW 19 32012513 missense probably benign
R7010:Asah2 UTSW 19 32054554 missense probably benign 0.00
R7404:Asah2 UTSW 19 32057854 missense probably benign 0.13
R7575:Asah2 UTSW 19 32016703 missense probably benign 0.11
R7797:Asah2 UTSW 19 32022361 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAAGGGCATCCACCTATG -3'
(R):5'- AGTCTCCTGAGGATGCAACC -3'

Sequencing Primer
(F):5'- ACACCTTACTTTGAAGGTAGGAG -3'
(R):5'- CTCGCTGAAAAAGATTGCCAGTCTG -3'
Posted On2014-08-25