Mutagenetix > Incidental Mutations

Incidental Mutation 'R2045:Asah2'

221903

Institutional Source

Beutler Lab

Gene Symbol

Asah2

Ensembl Gene

ENSMUSG00000024887

Gene Name

N-acylsphingosine amidohydrolase 2

Synonyms

neutral/alkaline ceramidase

MMRRC Submission

040052-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.223) question?

Stock #

R2045 (G1)

Quality Score

219

Status

Validated

Chromosome

Chromosomal Location

31984654-32061469 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 32052956 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 105 (N105K)

Ref Sequence

ENSEMBL: ENSMUSP00000093830 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096119]

Predicted Effect

probably benign
Transcript: ENSMUST00000096119
AA Change: N105K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000093830
Gene: ENSMUSG00000024887
AA Change: N105K

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	56	67	N/A	INTRINSIC
Pfam:Ceramidase_alk	78	584	1.4e-222	PFAM
Pfam:Ceramidse_alk_C	586	753	8e-50	PFAM

Meta Mutation Damage Score

0.1394

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.6%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ceramidases (EC 3.5.1.23), such as ASAH2, catalyze hydrolysis of the N-acyl linkage of ceramide, a second messenger in a variety of cellular events, to produce sphingosine. Sphingosine exerts both mitogenic and apoptosis-inducing activities, and its phosphorylated form functions as an intra- and intercellular second messenger (see MIM 603730) (Mitsutake et al., 2001 [PubMed 11328816]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are defective in the intestinal digestion of dietary ceramide but exhibit a normal life span with no obvious abnormalities or significant alterations in total ceramide levels in major organ tissues. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acta2	C	T	19: 34,243,399	G303E	probably damaging	Het
Adamts1	A	T	16: 85,795,976	Y515N	probably damaging	Het
Ankef1	T	C	2: 136,554,738	V695A	probably benign	Het
Ankrd63	C	A	2: 118,703,353		probably benign	Het
Atf2	A	C	2: 73,863,208	D3E	probably damaging	Het
Atp5f1	T	C	3: 105,943,874		probably benign	Het
Bag4	C	T	8: 25,769,488	A228T	probably benign	Het
Bms1	A	C	6: 118,392,627	L960W	probably damaging	Het
Cacna1c	A	G	6: 118,656,137	V977A	probably damaging	Het
Cadps2	A	G	6: 23,839,122	S6P	possibly damaging	Het
Capn8	A	G	1: 182,613,386	T462A	probably benign	Het
Cd226	T	C	18: 89,207,362	S128P	probably benign	Het
Cd33	G	T	7: 43,529,892	H278N	probably benign	Het
Cdh1	T	C	8: 106,666,182		probably benign	Het
Cfap54	T	C	10: 93,038,809		probably null	Het
Chit1	A	G	1: 134,151,144	I397M	probably benign	Het
Cic	C	A	7: 25,271,536	Q231K	possibly damaging	Het
Clca4b	A	G	3: 144,925,163	V312A	probably damaging	Het
Cngb1	T	A	8: 95,297,085		probably null	Het
Cyfip2	T	C	11: 46,249,789	I430V	probably benign	Het
Dnah12	A	G	14: 26,781,528	E1613G	probably null	Het
Dock2	T	C	11: 34,294,106		probably null	Het
Dync2h1	A	T	9: 7,160,171	F646I	probably damaging	Het
Eef1b2	A	T	1: 63,179,487	K144*	probably null	Het
Erap1	T	C	13: 74,669,450	V137A	probably benign	Het
Fam196a	T	G	7: 134,918,430	K124Q	probably damaging	Het
Far1	A	T	7: 113,539,271		probably null	Het
Fbn2	A	T	18: 58,090,658	C807S	probably damaging	Het
Fgfr1	A	G	8: 25,558,215	K209R	probably benign	Het
Fpr-rs4	CAGGAA	CA	17: 18,022,334		probably null	Het
Frem2	A	T	3: 53,535,744	V2533D	probably damaging	Het
Hip1r	T	C	5: 124,000,731	M839T	probably benign	Het
Igfbp2	A	G	1: 72,852,151	S303G	probably benign	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Itgb3	T	G	11: 104,623,413	S27A	probably benign	Het
Kif21b	G	A	1: 136,160,313	D1015N	probably damaging	Het
Krt7	A	T	15: 101,423,484		probably null	Het
Krtdap	T	A	7: 30,790,585	F80L	probably benign	Het
Lcp1	A	T	14: 75,200,401	T84S	probably benign	Het
Lipi	G	A	16: 75,550,199	T444I	probably damaging	Het
Lrguk	A	T	6: 34,071,068	E316V	probably damaging	Het
Lypd1	G	A	1: 125,910,535		probably benign	Het
Med12l	A	T	3: 59,262,310	K1632*	probably null	Het
Mrgpra9	A	T	7: 47,235,835	M28K	probably benign	Het
Mylk	A	G	16: 34,953,653	K1291E	probably benign	Het
Nek4	T	A	14: 30,953,923	W72R	probably damaging	Het
Nudt8	T	C	19: 4,001,899	V170A	probably damaging	Het
Oosp3	T	A	19: 11,699,369	Y31N	probably benign	Het
Padi2	A	T	4: 140,937,930	R449W	probably damaging	Het
Pcf11	G	T	7: 92,661,879	N300K	probably damaging	Het
Pcsk5	T	C	19: 17,581,144	D633G	possibly damaging	Het
Phlpp2	T	A	8: 109,907,600	W271R	probably damaging	Het
Pikfyve	T	C	1: 65,253,353	V1276A	probably benign	Het
Pkhd1l1	A	T	15: 44,479,654	N176Y	probably damaging	Het
Pop5	T	G	5: 115,238,212	V33G	possibly damaging	Het
Prkag2	A	G	5: 24,947,582	F175L	possibly damaging	Het
Ptpn22	T	A	3: 103,874,021	D79E	possibly damaging	Het
Rab32	T	G	10: 10,550,833	D123A	probably damaging	Het
Rnpc3	T	C	3: 113,608,360	K513E	possibly damaging	Het
Senp1	A	T	15: 98,059,944	F358I	possibly damaging	Het
Sft2d2	A	G	1: 165,185,078	L83P	probably damaging	Het
Slc9c1	G	A	16: 45,580,250	R741H	probably damaging	Het
Smad4	A	T	18: 73,649,806	Y352*	probably null	Het
Tamm41	T	A	6: 115,016,095	Q232H	probably benign	Het
Tbx6	T	A	7: 126,782,883	L131Q	probably damaging	Het
Trappc10	T	C	10: 78,209,479		probably benign	Het
Trp53bp1	C	A	2: 121,204,483	A108S	probably benign	Het
Unc13b	G	A	4: 43,091,266	V31M	probably damaging	Het
Usp24	T	C	4: 106,400,980	M1525T	possibly damaging	Het
Vax2	G	A	6: 83,711,270		probably benign	Het
Vcan	T	A	13: 89,690,985	I2147L	probably benign	Het
Zbtb7a	C	A	10: 81,144,410	A146E	probably benign	Het
Zcchc6	T	C	13: 59,800,656	Y215C	probably damaging	Het
Zfp287	A	G	11: 62,727,569	L157P	probably damaging	Het

Other mutations in Asah2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01108:Asah2	APN	19	32008681	splice site	probably benign
IGL02001:Asah2	APN	19	32043539	nonsense	probably null
IGL02228:Asah2	APN	19	32016714	missense	probably benign	0.09
IGL02377:Asah2	APN	19	32009414	missense	probably benign	0.30
IGL03070:Asah2	APN	19	32006344	missense	probably damaging	1.00
IGL03233:Asah2	APN	19	32054631	missense	probably benign	0.18
IGL03244:Asah2	APN	19	31986942	missense	probably damaging	1.00
R0008:Asah2	UTSW	19	32003731	nonsense	probably null
R0103:Asah2	UTSW	19	32018977	missense	probably benign	0.01
R0103:Asah2	UTSW	19	32018977	missense	probably benign	0.01
R0302:Asah2	UTSW	19	32052956	missense	probably benign	0.01
R0497:Asah2	UTSW	19	32054631	missense	probably benign	0.18
R0614:Asah2	UTSW	19	32016728	missense	probably damaging	1.00
R0639:Asah2	UTSW	19	32008639	missense	probably damaging	0.99
R0715:Asah2	UTSW	19	32016776	missense	probably damaging	0.97
R1332:Asah2	UTSW	19	32044941	missense	probably damaging	1.00
R1336:Asah2	UTSW	19	32044941	missense	probably damaging	1.00
R2062:Asah2	UTSW	19	32024874	missense	probably damaging	0.99
R4083:Asah2	UTSW	19	31986784	missense	probably benign	0.01
R4698:Asah2	UTSW	19	32054471	splice site	probably null
R4731:Asah2	UTSW	19	31995358	missense	probably benign	0.41
R4732:Asah2	UTSW	19	31995358	missense	probably benign	0.41
R4733:Asah2	UTSW	19	31995358	missense	probably benign	0.41
R4773:Asah2	UTSW	19	32052858	missense	probably damaging	1.00
R4930:Asah2	UTSW	19	32052906	missense	probably benign	0.35
R5081:Asah2	UTSW	19	32014308	missense	probably benign	0.07
R5741:Asah2	UTSW	19	32008615	missense	probably damaging	1.00
R5873:Asah2	UTSW	19	32003682	critical splice donor site	probably null
R5905:Asah2	UTSW	19	32016514	missense	probably damaging	1.00
R6027:Asah2	UTSW	19	32044951	missense	probably benign	0.01
R6028:Asah2	UTSW	19	32016514	missense	probably damaging	1.00
R6187:Asah2	UTSW	19	32024867	missense	probably damaging	0.99
R6667:Asah2	UTSW	19	31995358	missense	probably benign	0.41
R6968:Asah2	UTSW	19	32012513	missense	probably benign
R7010:Asah2	UTSW	19	32054554	missense	probably benign	0.00
R7404:Asah2	UTSW	19	32057854	missense	probably benign	0.13
R7575:Asah2	UTSW	19	32016703	missense	probably benign	0.11
R7797:Asah2	UTSW	19	32022361	missense	probably damaging	1.00
R8492:Asah2	UTSW	19	32006259	missense	probably benign	0.25
R8682:Asah2	UTSW	19	32052877	missense	probably damaging	1.00
R8766:Asah2	UTSW	19	32057880	missense	possibly damaging	0.46
R8873:Asah2	UTSW	19	32044888	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGGAAGGGCATCCACCTATG -3'
(R):5'- AGTCTCCTGAGGATGCAACC -3'

Sequencing Primer
(F):5'- ACACCTTACTTTGAAGGTAGGAG -3'
(R):5'- CTCGCTGAAAAAGATTGCCAGTCTG -3'

Posted On

2014-08-25