Incidental Mutation 'R1977:Parp8'
ID221907
Institutional Source Beutler Lab
Gene Symbol Parp8
Ensembl Gene ENSMUSG00000021725
Gene Namepoly (ADP-ribose) polymerase family, member 8
SynonymsD13Ertd275e, 2810430O08Rik
MMRRC Submission 039990-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1977 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location116854820-117025537 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116910913 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 208 (I208F)
Ref Sequence ENSEMBL: ENSMUSP00000153188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022239] [ENSMUST00000223949] [ENSMUST00000225344] [ENSMUST00000226107]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022239
AA Change: I247F

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022239
Gene: ENSMUSG00000021725
AA Change: I247F

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 163 174 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
internal_repeat_1 332 410 4.61e-10 PROSPERO
internal_repeat_1 404 476 4.61e-10 PROSPERO
low complexity region 497 514 N/A INTRINSIC
Pfam:PARP 712 839 2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223949
AA Change: I208F

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000225344
Predicted Effect probably damaging
Transcript: ENSMUST00000226107
AA Change: I208F

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 99% (66/67)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf3 G T 8: 122,781,533 C256F probably damaging Het
Adgra2 T A 8: 27,115,761 V647D possibly damaging Het
AI593442 A T 9: 52,678,192 S28R probably damaging Het
Akr1c21 G C 13: 4,574,212 G22R probably damaging Het
Ampd3 T C 7: 110,803,162 W458R probably damaging Het
Arhgap23 G T 11: 97,451,447 R185L possibly damaging Het
Arhgap45 A T 10: 80,020,818 I67F probably damaging Het
Asah1 A G 8: 41,343,517 probably null Het
Atl2 A G 17: 79,852,590 Y56H probably damaging Het
Carf A T 1: 60,146,136 I447F probably damaging Het
Crmp1 A G 5: 37,276,283 N162S probably damaging Het
Cyp2a5 A G 7: 26,835,922 E103G probably benign Het
Cyp2c40 T C 19: 39,778,041 D370G probably damaging Het
Dhrs2 T A 14: 55,234,655 M1K probably null Het
Dnah17 T C 11: 118,112,591 E810G possibly damaging Het
E2f5 T A 3: 14,587,356 I84N probably damaging Het
Eif2ak4 A T 2: 118,461,757 K1185* probably null Het
Eif4ebp1 T A 8: 27,275,101 M115K probably damaging Het
Evi5 A T 5: 107,799,139 L505* probably null Het
Fbxw25 T A 9: 109,652,856 Y254F possibly damaging Het
Gm7964 T A 7: 83,757,352 F439Y possibly damaging Het
Gps1 A G 11: 120,785,826 T124A probably damaging Het
Hopx T C 5: 77,117,616 probably benign Het
Hoxd3 A G 2: 74,744,276 S89G possibly damaging Het
Hrc A T 7: 45,336,214 D263V probably damaging Het
Hs6st3 T C 14: 119,138,476 I21T probably benign Het
Izumo4 A G 10: 80,703,121 Y106C probably damaging Het
Lama2 A T 10: 26,990,800 probably null Het
Lcorl A C 5: 45,775,420 S123R probably null Het
Lgr4 A T 2: 110,011,928 I729F probably damaging Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Matn3 T A 12: 8,961,110 probably benign Het
Mdc1 T A 17: 35,850,930 S912T probably benign Het
Mgam G A 6: 40,664,880 V556I probably benign Het
Myom2 A T 8: 15,085,263 I489F possibly damaging Het
Nfatc2 G A 2: 168,504,459 T905I possibly damaging Het
Nme6 G A 9: 109,835,341 R6Q probably damaging Het
Nr1h5 A G 3: 102,947,817 S323P probably damaging Het
Nr4a3 C A 4: 48,056,539 R364S probably damaging Het
Obox7 A T 7: 14,664,398 D79V probably damaging Het
Olfr167 G A 16: 19,514,836 P267S probably damaging Het
Olfr374 G A 8: 72,109,854 G96D probably benign Het
Olfr435 T A 6: 43,201,980 V112D possibly damaging Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Pdgfc C T 3: 81,209,245 T302I probably damaging Het
Pnpt1 A G 11: 29,141,256 I337V probably benign Het
Polk T C 13: 96,489,228 E436G probably damaging Het
Pramel7 A G 2: 87,491,121 V190A probably benign Het
Rplp2 T C 7: 141,448,781 probably benign Het
Sec23ip T A 7: 128,766,273 S670T probably damaging Het
Sgk2 A G 2: 163,004,160 N207S probably benign Het
Sh2d2a C T 3: 87,851,816 Q242* probably null Het
Sh3pxd2b A C 11: 32,422,138 N435T probably damaging Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Stx17 G A 4: 48,181,553 V241M probably benign Het
Taok3 A T 5: 117,265,924 K721N probably damaging Het
Tbxas1 A G 6: 38,948,641 probably benign Het
Tmem87a G A 2: 120,374,504 A377V probably benign Het
Topaz1 C T 9: 122,747,362 T6M unknown Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Vmn2r125 A G 4: 156,354,591 probably null Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Wdr59 A T 8: 111,458,638 C888S probably benign Het
Other mutations in Parp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Parp8 APN 13 116927323 missense probably damaging 1.00
IGL01346:Parp8 APN 13 116895064 missense possibly damaging 0.72
IGL01793:Parp8 APN 13 116910879 missense probably damaging 1.00
IGL01926:Parp8 APN 13 116862302 splice site probably benign
IGL01958:Parp8 APN 13 116876572 missense probably benign 0.14
IGL02131:Parp8 APN 13 116910873 missense probably benign 0.08
IGL02398:Parp8 APN 13 116910863 critical splice donor site probably null
IGL02496:Parp8 APN 13 116862302 splice site probably benign
IGL03135:Parp8 APN 13 116910942 missense probably benign 0.41
IGL03143:Parp8 APN 13 116910961 splice site probably benign
IGL03201:Parp8 APN 13 116863069 splice site probably benign
blondi UTSW 13 116893041 missense possibly damaging 0.77
Heidi UTSW 13 116862204 splice site probably null
R0362:Parp8 UTSW 13 116924968 nonsense probably null
R0699:Parp8 UTSW 13 116922584 missense probably benign 0.01
R1445:Parp8 UTSW 13 117025350 utr 5 prime probably null
R1676:Parp8 UTSW 13 116877528 missense probably damaging 0.99
R2019:Parp8 UTSW 13 116868432 splice site probably benign
R2049:Parp8 UTSW 13 116894886 missense probably benign 0.20
R2142:Parp8 UTSW 13 116894886 missense probably benign 0.20
R2474:Parp8 UTSW 13 116893041 missense possibly damaging 0.77
R2566:Parp8 UTSW 13 116895687 missense possibly damaging 0.78
R3863:Parp8 UTSW 13 116894767 missense probably benign 0.01
R4126:Parp8 UTSW 13 116868469 missense possibly damaging 0.94
R4518:Parp8 UTSW 13 116895673 missense possibly damaging 0.62
R4519:Parp8 UTSW 13 116895673 missense possibly damaging 0.62
R4767:Parp8 UTSW 13 116868536 missense probably damaging 0.99
R5355:Parp8 UTSW 13 116862204 splice site probably null
R5633:Parp8 UTSW 13 116876580 missense probably damaging 1.00
R5942:Parp8 UTSW 13 116869433 missense probably benign 0.12
R5978:Parp8 UTSW 13 116895732 missense probably benign 0.01
R6039:Parp8 UTSW 13 116877598 missense probably damaging 1.00
R6039:Parp8 UTSW 13 116877598 missense probably damaging 1.00
R6753:Parp8 UTSW 13 116895115 missense possibly damaging 0.91
R7016:Parp8 UTSW 13 116895091 missense probably damaging 1.00
R7139:Parp8 UTSW 13 117025266 missense probably benign 0.21
R7305:Parp8 UTSW 13 116894925 missense possibly damaging 0.95
R7314:Parp8 UTSW 13 116868460 missense probably benign 0.01
R7360:Parp8 UTSW 13 116895771 missense probably benign 0.02
R7526:Parp8 UTSW 13 116894805 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTTGCTGAGCACAGAGC -3'
(R):5'- GACTGACTGATCAATGAAGCTGAG -3'

Sequencing Primer
(F):5'- GAGCCCACACAGTTATCAAGATG -3'
(R):5'- GCTGAGATAATAGATCTTTCTCACTG -3'
Posted On2014-08-25