Mutagenetix > Incidental Mutations

Incidental Mutation 'R2046:Olfr1099'

221926

Institutional Source

Beutler Lab

Gene Symbol

Olfr1099

Ensembl Gene

ENSMUSG00000075168

Gene Name

olfactory receptor 1099

Synonyms

MOR206-3, GA_x6K02T2Q125-48446067-48445129

MMRRC Submission

040053-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R2046 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86955126-86960693 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 86958733 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 242 (A242S)

Ref Sequence

ENSEMBL: ENSMUSP00000149528 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099871] [ENSMUST00000213456]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099871
AA Change: A242S

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000097456
Gene: ENSMUSG00000075168
AA Change: A242S

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	5.9e-54	PFAM
Pfam:7tm_1	41	290	1.2e-19	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213456
AA Change: A242S

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)

Meta Mutation Damage Score

0.1259

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

97% (71/73)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	T	A	2: 130,810,917	I42L	possibly damaging	Het
4930503L19Rik	T	A	18: 70,467,482	D84V	probably damaging	Het
Abcc5	A	T	16: 20,399,817	S272T	possibly damaging	Het
Adgre4	A	G	17: 55,778,847	N49D	possibly damaging	Het
Ap2b1	A	T	11: 83,336,386	Y328F	probably benign	Het
Arhgef33	G	C	17: 80,373,466	E678D	probably benign	Het
Arid2	G	A	15: 96,369,387	V583I	probably damaging	Het
Bdkrb1	T	A	12: 105,604,726	S184T	probably benign	Het
Bend3	T	C	10: 43,511,846	F745S	probably damaging	Het
Card10	A	T	15: 78,787,473	V597E	possibly damaging	Het
Casp3	T	A	8: 46,629,726		probably benign	Het
Ccnb2	A	G	9: 70,409,347	V340A	probably benign	Het
Cdkl3	G	T	11: 52,026,850	V325L	probably benign	Het
Clec4n	T	A	6: 123,246,504	N153K	probably benign	Het
Crtac1	C	T	19: 42,334,053	V83I	probably damaging	Het
Cul9	C	A	17: 46,543,733	L14F	probably damaging	Het
Dgka	T	C	10: 128,723,535	Y519C	probably damaging	Het
Dhrs7	T	G	12: 72,652,266	K314T	possibly damaging	Het
Dnah10	G	T	5: 124,796,341	K2542N	probably benign	Het
Dock5	A	T	14: 67,812,142	V731E	probably benign	Het
Dpy19l1	T	A	9: 24,423,159	H571L	probably damaging	Het
Dzip1	A	T	14: 118,922,478	I106N	probably damaging	Het
Eif2ak4	A	T	2: 118,451,408		probably benign	Het
Epha4	T	C	1: 77,507,162	Y70C	probably damaging	Het
Eps15	T	C	4: 109,370,596	F344S	probably damaging	Het
Erbb4	C	T	1: 68,298,323	R612Q	probably benign	Het
Fam83h	T	C	15: 76,002,938	H850R	probably benign	Het
Fancg	A	G	4: 43,004,604	C484R	probably damaging	Het
Fzd9	A	G	5: 135,249,684	I449T	probably damaging	Het
Gm10647	A	G	9: 66,798,237		probably benign	Het
Gm4951	T	A	18: 60,245,499	H35Q	probably benign	Het
Itga11	C	T	9: 62,727,697	L86F	probably damaging	Het
Lamc2	C	T	1: 153,141,765	R492H	probably benign	Het
March6	A	G	15: 31,486,434	V325A	probably benign	Het
Myo5b	A	T	18: 74,577,455	I47F	probably benign	Het
Nek9	T	A	12: 85,320,707		probably benign	Het
Nelfb	T	A	2: 25,206,311	N262I	probably damaging	Het
Neurl4	A	G	11: 69,908,697	D942G	probably damaging	Het
Nipbl	G	A	15: 8,324,467	P1729S	probably benign	Het
Nr4a3	A	G	4: 48,067,807	T468A	possibly damaging	Het
Nrm	G	A	17: 35,864,217	V146I	probably benign	Het
Pitx3	T	C	19: 46,137,179	E42G	possibly damaging	Het
Pkd1l2	C	T	8: 116,999,955	A2271T	probably damaging	Het
Pofut2	A	G	10: 77,260,594	N51S	probably damaging	Het
Ppp1r3a	T	C	6: 14,722,104	E273G	probably benign	Het
Psme4	A	G	11: 30,817,723		probably benign	Het
Pus7l	T	C	15: 94,540,785	I60V	probably benign	Het
Pygo2	T	A	3: 89,433,148	N284K	possibly damaging	Het
Ralgapa1	C	T	12: 55,695,160	C1368Y	probably damaging	Het
Rbm45	G	A	2: 76,375,398	G198E	probably benign	Het
Reln	T	C	5: 21,942,627	I2442V	probably benign	Het
Rmi1	T	C	13: 58,407,958	V7A	probably benign	Het
Rsf1	T	C	7: 97,661,677	L538P	probably benign	Het
Rsph4a	T	G	10: 33,914,543		probably benign	Het
Sardh	A	T	2: 27,215,082	D676E	possibly damaging	Het
Sh3tc2	A	G	18: 61,990,843	M892V	probably benign	Het
Slc38a11	A	G	2: 65,358,185	F80S	probably damaging	Het
Slc6a2	C	A	8: 92,972,926	S194*	probably null	Het
Slco2b1	A	G	7: 99,690,479	F86L	probably damaging	Het
Smc3	G	A	19: 53,639,414	D875N	probably benign	Het
Sp100	G	A	1: 85,709,065	E575K	possibly damaging	Het
Spns2	A	G	11: 72,459,040	L196P	possibly damaging	Het
Taf8	A	G	17: 47,490,276	S261P	probably benign	Het
Trim2	A	G	3: 84,208,289	L86P	probably damaging	Het
Ttn	C	A	2: 76,907,794	V4134F	probably benign	Het
Ush2a	A	G	1: 188,356,927	T360A	probably benign	Het
Usp28	T	A	9: 49,039,075	C935S	probably damaging	Het
Vps37d	T	A	5: 135,073,977	M134L	probably benign	Het
Vwa2	T	G	19: 56,905,578	V329G	probably benign	Het
Zfp110	A	G	7: 12,849,422	R666G	probably benign	Het

Other mutations in Olfr1099

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01110:Olfr1099	APN	2	86958921	missense	possibly damaging	0.90
IGL01624:Olfr1099	APN	2	86959230	missense	probably benign	0.05
IGL02119:Olfr1099	APN	2	86959183	missense	probably benign	0.24
IGL02433:Olfr1099	APN	2	86959048	missense	possibly damaging	0.63
IGL02646:Olfr1099	APN	2	86959353	missense	probably damaging	1.00
IGL02824:Olfr1099	APN	2	86958993	missense	probably benign	0.03
IGL03228:Olfr1099	APN	2	86958706	missense	probably benign	0.16
R0208:Olfr1099	UTSW	2	86959404	missense	probably damaging	0.96
R0521:Olfr1099	UTSW	2	86958846	missense	probably damaging	1.00
R0783:Olfr1099	UTSW	2	86958562	missense	probably benign
R1706:Olfr1099	UTSW	2	86959080	missense	probably damaging	1.00
R1859:Olfr1099	UTSW	2	86959081	missense	probably damaging	0.99
R2126:Olfr1099	UTSW	2	86959098	missense	possibly damaging	0.63
R2140:Olfr1099	UTSW	2	86959281	missense	probably damaging	1.00
R4452:Olfr1099	UTSW	2	86958699	missense	probably damaging	0.99
R4680:Olfr1099	UTSW	2	86959321	missense	possibly damaging	0.87
R4958:Olfr1099	UTSW	2	86959105	missense	possibly damaging	0.75
R4970:Olfr1099	UTSW	2	86959354	missense	probably damaging	1.00
R5112:Olfr1099	UTSW	2	86959354	missense	probably damaging	1.00
R5532:Olfr1099	UTSW	2	86958580	nonsense	probably null
R5691:Olfr1099	UTSW	2	86959272	missense	probably damaging	1.00
R6851:Olfr1099	UTSW	2	86959267	missense	possibly damaging	0.46
R6858:Olfr1099	UTSW	2	86958690	missense	probably benign	0.11
R7368:Olfr1099	UTSW	2	86959258	missense	probably damaging	1.00
Z1088:Olfr1099	UTSW	2	86958666	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTGGAATTCTAATTCTCTGTTGCTG -3'
(R):5'- TTATAGCCCTCTCATGCAGC -3'

Sequencing Primer
(F):5'- TGACCTTTGGCATAATTGTTACC -3'
(R):5'- TGCAGCAACACACATGATATTG -3'

Posted On

2014-08-25