Incidental Mutation 'R2046:Fzd9'
ID221949
Institutional Source Beutler Lab
Gene Symbol Fzd9
Ensembl Gene ENSMUSG00000049551
Gene Namefrizzled class receptor 9
Synonymsmfz9, frizzled 9
MMRRC Submission 040053-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.389) question?
Stock #R2046 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location135248938-135251230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135249684 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 449 (I449T)
Ref Sequence ENSEMBL: ENSMUSP00000053551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002825] [ENSMUST00000062572]
Predicted Effect probably benign
Transcript: ENSMUST00000002825
SMART Domains Protein: ENSMUSP00000002825
Gene: ENSMUSG00000002748

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 21 120 2.6e-28 PFAM
low complexity region 312 335 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
coiled coil region 537 587 N/A INTRINSIC
DDT 605 669 5.59e-17 SMART
Pfam:WHIM1 725 773 2.2e-9 PFAM
low complexity region 822 835 N/A INTRINSIC
coiled coil region 854 890 N/A INTRINSIC
Pfam:WHIM2 900 935 1.3e-10 PFAM
Pfam:WHIM3 991 1029 1.5e-16 PFAM
low complexity region 1131 1148 N/A INTRINSIC
PHD 1186 1232 1.89e-14 SMART
RING 1187 1231 7.85e-2 SMART
low complexity region 1245 1277 N/A INTRINSIC
BROMO 1333 1441 3.63e-37 SMART
low complexity region 1459 1472 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000062572
AA Change: I449T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053551
Gene: ENSMUSG00000049551
AA Change: I449T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FRI 39 158 1.97e-73 SMART
low complexity region 177 195 N/A INTRINSIC
Frizzled 222 548 4.64e-199 SMART
Meta Mutation Damage Score 0.296 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the 'frizzled' gene family encode 7-transmembrane domain proteins that are receptors for Wnt signaling proteins. The FZD9 gene is located within the Williams syndrome common deletion region of chromosome 7, and heterozygous deletion of the FZD9 gene may contribute to the Williams syndrome phenotype. FZD9 is expressed predominantly in brain, testis, eye, skeletal muscle, and kidney. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one allele exhibit immune system abnormalities while another null allele causes neurological abnormalities. A third null mutation results in growth retardation and abnormalities in bone mineralization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik T A 2: 130,810,917 I42L possibly damaging Het
4930503L19Rik T A 18: 70,467,482 D84V probably damaging Het
Abcc5 A T 16: 20,399,817 S272T possibly damaging Het
Adgre4 A G 17: 55,778,847 N49D possibly damaging Het
Ap2b1 A T 11: 83,336,386 Y328F probably benign Het
Arhgef33 G C 17: 80,373,466 E678D probably benign Het
Arid2 G A 15: 96,369,387 V583I probably damaging Het
Bdkrb1 T A 12: 105,604,726 S184T probably benign Het
Bend3 T C 10: 43,511,846 F745S probably damaging Het
Card10 A T 15: 78,787,473 V597E possibly damaging Het
Casp3 T A 8: 46,629,726 probably benign Het
Ccnb2 A G 9: 70,409,347 V340A probably benign Het
Cdkl3 G T 11: 52,026,850 V325L probably benign Het
Clec4n T A 6: 123,246,504 N153K probably benign Het
Crtac1 C T 19: 42,334,053 V83I probably damaging Het
Cul9 C A 17: 46,543,733 L14F probably damaging Het
Dgka T C 10: 128,723,535 Y519C probably damaging Het
Dhrs7 T G 12: 72,652,266 K314T possibly damaging Het
Dnah10 G T 5: 124,796,341 K2542N probably benign Het
Dock5 A T 14: 67,812,142 V731E probably benign Het
Dpy19l1 T A 9: 24,423,159 H571L probably damaging Het
Dzip1 A T 14: 118,922,478 I106N probably damaging Het
Eif2ak4 A T 2: 118,451,408 probably benign Het
Epha4 T C 1: 77,507,162 Y70C probably damaging Het
Eps15 T C 4: 109,370,596 F344S probably damaging Het
Erbb4 C T 1: 68,298,323 R612Q probably benign Het
Fam83h T C 15: 76,002,938 H850R probably benign Het
Fancg A G 4: 43,004,604 C484R probably damaging Het
Gm10647 A G 9: 66,798,237 probably benign Het
Gm4951 T A 18: 60,245,499 H35Q probably benign Het
Itga11 C T 9: 62,727,697 L86F probably damaging Het
Lamc2 C T 1: 153,141,765 R492H probably benign Het
March6 A G 15: 31,486,434 V325A probably benign Het
Myo5b A T 18: 74,577,455 I47F probably benign Het
Nek9 T A 12: 85,320,707 probably benign Het
Nelfb T A 2: 25,206,311 N262I probably damaging Het
Neurl4 A G 11: 69,908,697 D942G probably damaging Het
Nipbl G A 15: 8,324,467 P1729S probably benign Het
Nr4a3 A G 4: 48,067,807 T468A possibly damaging Het
Nrm G A 17: 35,864,217 V146I probably benign Het
Olfr1099 C A 2: 86,958,733 A242S possibly damaging Het
Pitx3 T C 19: 46,137,179 E42G possibly damaging Het
Pkd1l2 C T 8: 116,999,955 A2271T probably damaging Het
Pofut2 A G 10: 77,260,594 N51S probably damaging Het
Ppp1r3a T C 6: 14,722,104 E273G probably benign Het
Psme4 A G 11: 30,817,723 probably benign Het
Pus7l T C 15: 94,540,785 I60V probably benign Het
Pygo2 T A 3: 89,433,148 N284K possibly damaging Het
Ralgapa1 C T 12: 55,695,160 C1368Y probably damaging Het
Rbm45 G A 2: 76,375,398 G198E probably benign Het
Reln T C 5: 21,942,627 I2442V probably benign Het
Rmi1 T C 13: 58,407,958 V7A probably benign Het
Rsf1 T C 7: 97,661,677 L538P probably benign Het
Rsph4a T G 10: 33,914,543 probably benign Het
Sardh A T 2: 27,215,082 D676E possibly damaging Het
Sh3tc2 A G 18: 61,990,843 M892V probably benign Het
Slc38a11 A G 2: 65,358,185 F80S probably damaging Het
Slc6a2 C A 8: 92,972,926 S194* probably null Het
Slco2b1 A G 7: 99,690,479 F86L probably damaging Het
Smc3 G A 19: 53,639,414 D875N probably benign Het
Sp100 G A 1: 85,709,065 E575K possibly damaging Het
Spns2 A G 11: 72,459,040 L196P possibly damaging Het
Taf8 A G 17: 47,490,276 S261P probably benign Het
Trim2 A G 3: 84,208,289 L86P probably damaging Het
Ttn C A 2: 76,907,794 V4134F probably benign Het
Ush2a A G 1: 188,356,927 T360A probably benign Het
Usp28 T A 9: 49,039,075 C935S probably damaging Het
Vps37d T A 5: 135,073,977 M134L probably benign Het
Vwa2 T G 19: 56,905,578 V329G probably benign Het
Zfp110 A G 7: 12,849,422 R666G probably benign Het
Other mutations in Fzd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Fzd9 APN 5 135249469 missense probably damaging 1.00
IGL01446:Fzd9 APN 5 135250566 missense probably damaging 1.00
IGL02510:Fzd9 APN 5 135249615 missense probably damaging 1.00
R0308:Fzd9 UTSW 5 135249406 missense probably damaging 0.97
R0417:Fzd9 UTSW 5 135249619 missense probably damaging 0.99
R1563:Fzd9 UTSW 5 135250554 missense probably damaging 0.96
R1638:Fzd9 UTSW 5 135249748 missense probably damaging 1.00
R1840:Fzd9 UTSW 5 135249571 missense probably benign
R2268:Fzd9 UTSW 5 135250294 missense probably damaging 1.00
R2898:Fzd9 UTSW 5 135249846 missense probably damaging 1.00
R4078:Fzd9 UTSW 5 135249636 missense probably benign 0.01
R4079:Fzd9 UTSW 5 135249636 missense probably benign 0.01
R4576:Fzd9 UTSW 5 135250312 missense probably damaging 1.00
R4662:Fzd9 UTSW 5 135249621 missense probably damaging 1.00
R4956:Fzd9 UTSW 5 135249942 missense probably damaging 1.00
R5096:Fzd9 UTSW 5 135249859 missense probably damaging 0.96
R5227:Fzd9 UTSW 5 135249606 missense probably benign 0.06
R5452:Fzd9 UTSW 5 135250860 missense probably damaging 1.00
R5475:Fzd9 UTSW 5 135250269 unclassified probably null
R5888:Fzd9 UTSW 5 135249463 unclassified probably null
R5914:Fzd9 UTSW 5 135249345 missense probably benign
R7148:Fzd9 UTSW 5 135249690 missense probably benign 0.40
R7544:Fzd9 UTSW 5 135249862 missense probably damaging 1.00
X0063:Fzd9 UTSW 5 135249721 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCAAGGACATGAAGATTTTGAGC -3'
(R):5'- CTGACTGGGCTCTGCTATGTAG -3'

Sequencing Primer
(F):5'- TTTTGAGCATGAAGACAGCCAC -3'
(R):5'- TATGTAGCCAGCATGGACCC -3'
Posted On2014-08-25