Incidental Mutation 'R2046:Zfp110'
ID221959
Institutional Source Beutler Lab
Gene Symbol Zfp110
Ensembl Gene ENSMUSG00000058638
Gene Namezinc finger protein 110
SynonymsNrif1, NRIF, 2900024E01Rik
MMRRC Submission 040053-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.555) question?
Stock #R2046 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location12834761-12850577 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12849422 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 666 (R666G)
Ref Sequence ENSEMBL: ENSMUSP00000132060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004614] [ENSMUST00000168247]
Predicted Effect probably benign
Transcript: ENSMUST00000004614
AA Change: R666G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000004614
Gene: ENSMUSG00000058638
AA Change: R666G

DomainStartEndE-ValueType
KRAB 18 78 1.38e-26 SMART
SCAN 158 269 1.48e-39 SMART
KRAB 284 351 2.94e-12 SMART
low complexity region 424 438 N/A INTRINSIC
ZnF_C2H2 688 710 1.43e-1 SMART
ZnF_C2H2 716 738 2.24e-3 SMART
ZnF_C2H2 744 766 2.27e-4 SMART
ZnF_C2H2 772 794 6.32e-3 SMART
ZnF_C2H2 800 822 2.75e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137718
Predicted Effect probably benign
Transcript: ENSMUST00000168247
AA Change: R666G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132060
Gene: ENSMUSG00000058638
AA Change: R666G

DomainStartEndE-ValueType
KRAB 18 78 1.38e-26 SMART
SCAN 158 269 1.48e-39 SMART
KRAB 284 351 2.94e-12 SMART
low complexity region 424 438 N/A INTRINSIC
ZnF_C2H2 688 710 1.43e-1 SMART
ZnF_C2H2 716 738 2.24e-3 SMART
ZnF_C2H2 744 766 2.27e-4 SMART
ZnF_C2H2 772 794 6.32e-3 SMART
ZnF_C2H2 800 822 2.75e-3 SMART
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (71/73)
MGI Phenotype PHENOTYPE: Homozygous mutants on a C57BL/6 background die at embryonic day 12. On a strain 129 background, mutants are viable and fertile, but males are more docile and testis weight is greatly reduced. On an F2 background, 20% of homozygous pups die neonatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik T A 2: 130,810,917 I42L possibly damaging Het
4930503L19Rik T A 18: 70,467,482 D84V probably damaging Het
Abcc5 A T 16: 20,399,817 S272T possibly damaging Het
Adgre4 A G 17: 55,778,847 N49D possibly damaging Het
Ap2b1 A T 11: 83,336,386 Y328F probably benign Het
Arhgef33 G C 17: 80,373,466 E678D probably benign Het
Arid2 G A 15: 96,369,387 V583I probably damaging Het
Bdkrb1 T A 12: 105,604,726 S184T probably benign Het
Bend3 T C 10: 43,511,846 F745S probably damaging Het
Card10 A T 15: 78,787,473 V597E possibly damaging Het
Casp3 T A 8: 46,629,726 probably benign Het
Ccnb2 A G 9: 70,409,347 V340A probably benign Het
Cdkl3 G T 11: 52,026,850 V325L probably benign Het
Clec4n T A 6: 123,246,504 N153K probably benign Het
Crtac1 C T 19: 42,334,053 V83I probably damaging Het
Cul9 C A 17: 46,543,733 L14F probably damaging Het
Dgka T C 10: 128,723,535 Y519C probably damaging Het
Dhrs7 T G 12: 72,652,266 K314T possibly damaging Het
Dnah10 G T 5: 124,796,341 K2542N probably benign Het
Dock5 A T 14: 67,812,142 V731E probably benign Het
Dpy19l1 T A 9: 24,423,159 H571L probably damaging Het
Dzip1 A T 14: 118,922,478 I106N probably damaging Het
Eif2ak4 A T 2: 118,451,408 probably benign Het
Epha4 T C 1: 77,507,162 Y70C probably damaging Het
Eps15 T C 4: 109,370,596 F344S probably damaging Het
Erbb4 C T 1: 68,298,323 R612Q probably benign Het
Fam83h T C 15: 76,002,938 H850R probably benign Het
Fancg A G 4: 43,004,604 C484R probably damaging Het
Fzd9 A G 5: 135,249,684 I449T probably damaging Het
Gm10647 A G 9: 66,798,237 probably benign Het
Gm4951 T A 18: 60,245,499 H35Q probably benign Het
Itga11 C T 9: 62,727,697 L86F probably damaging Het
Lamc2 C T 1: 153,141,765 R492H probably benign Het
March6 A G 15: 31,486,434 V325A probably benign Het
Myo5b A T 18: 74,577,455 I47F probably benign Het
Nek9 T A 12: 85,320,707 probably benign Het
Nelfb T A 2: 25,206,311 N262I probably damaging Het
Neurl4 A G 11: 69,908,697 D942G probably damaging Het
Nipbl G A 15: 8,324,467 P1729S probably benign Het
Nr4a3 A G 4: 48,067,807 T468A possibly damaging Het
Nrm G A 17: 35,864,217 V146I probably benign Het
Olfr1099 C A 2: 86,958,733 A242S possibly damaging Het
Pitx3 T C 19: 46,137,179 E42G possibly damaging Het
Pkd1l2 C T 8: 116,999,955 A2271T probably damaging Het
Pofut2 A G 10: 77,260,594 N51S probably damaging Het
Ppp1r3a T C 6: 14,722,104 E273G probably benign Het
Psme4 A G 11: 30,817,723 probably benign Het
Pus7l T C 15: 94,540,785 I60V probably benign Het
Pygo2 T A 3: 89,433,148 N284K possibly damaging Het
Ralgapa1 C T 12: 55,695,160 C1368Y probably damaging Het
Rbm45 G A 2: 76,375,398 G198E probably benign Het
Reln T C 5: 21,942,627 I2442V probably benign Het
Rmi1 T C 13: 58,407,958 V7A probably benign Het
Rsf1 T C 7: 97,661,677 L538P probably benign Het
Rsph4a T G 10: 33,914,543 probably benign Het
Sardh A T 2: 27,215,082 D676E possibly damaging Het
Sh3tc2 A G 18: 61,990,843 M892V probably benign Het
Slc38a11 A G 2: 65,358,185 F80S probably damaging Het
Slc6a2 C A 8: 92,972,926 S194* probably null Het
Slco2b1 A G 7: 99,690,479 F86L probably damaging Het
Smc3 G A 19: 53,639,414 D875N probably benign Het
Sp100 G A 1: 85,709,065 E575K possibly damaging Het
Spns2 A G 11: 72,459,040 L196P possibly damaging Het
Taf8 A G 17: 47,490,276 S261P probably benign Het
Trim2 A G 3: 84,208,289 L86P probably damaging Het
Ttn C A 2: 76,907,794 V4134F probably benign Het
Ush2a A G 1: 188,356,927 T360A probably benign Het
Usp28 T A 9: 49,039,075 C935S probably damaging Het
Vps37d T A 5: 135,073,977 M134L probably benign Het
Vwa2 T G 19: 56,905,578 V329G probably benign Het
Other mutations in Zfp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Zfp110 APN 7 12849159 missense probably benign 0.38
IGL01094:Zfp110 APN 7 12849796 missense probably damaging 1.00
IGL01576:Zfp110 APN 7 12849671 missense probably damaging 1.00
IGL01859:Zfp110 APN 7 12849540 missense possibly damaging 0.86
IGL02003:Zfp110 APN 7 12849905 nonsense probably null
R0122:Zfp110 UTSW 7 12848597 missense possibly damaging 0.51
R0357:Zfp110 UTSW 7 12836375 missense probably damaging 0.98
R0383:Zfp110 UTSW 7 12849260 missense probably benign 0.00
R0725:Zfp110 UTSW 7 12836363 missense possibly damaging 0.52
R0926:Zfp110 UTSW 7 12849881 nonsense probably null
R1146:Zfp110 UTSW 7 12846794 critical splice acceptor site probably null
R1146:Zfp110 UTSW 7 12846794 critical splice acceptor site probably null
R1472:Zfp110 UTSW 7 12848541 missense possibly damaging 0.85
R1663:Zfp110 UTSW 7 12848642 missense probably benign 0.08
R1975:Zfp110 UTSW 7 12848502 missense probably benign 0.00
R2296:Zfp110 UTSW 7 12849540 missense probably damaging 0.97
R2341:Zfp110 UTSW 7 12849186 missense probably benign 0.04
R4332:Zfp110 UTSW 7 12844571 nonsense probably null
R5892:Zfp110 UTSW 7 12848478 missense probably benign 0.00
R5955:Zfp110 UTSW 7 12848745 missense possibly damaging 0.85
R6083:Zfp110 UTSW 7 12844675 missense possibly damaging 0.95
R6115:Zfp110 UTSW 7 12849774 missense probably damaging 0.98
R7187:Zfp110 UTSW 7 12849826 nonsense probably null
R7455:Zfp110 UTSW 7 12848057 missense probably benign
R7570:Zfp110 UTSW 7 12849340 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CGTCCAAGGGAACAGGAATTC -3'
(R):5'- ATGCTTTCCCACAGGCCATAC -3'

Sequencing Primer
(F):5'- AGGAATTCCTGGAAACATATAAAACC -3'
(R):5'- ATACACATATATGGCCGCTCTC -3'
Posted On2014-08-25