Mutagenetix > Incidental Mutations

Incidental Mutation 'R1978:Cfap57'

221972

Institutional Source

Beutler Lab

Gene Symbol

Cfap57

Ensembl Gene

ENSMUSG00000028730

Gene Name

cilia and flagella associated protein 57

Synonyms

Wdr65, 1110020C03Rik, C130004B06Rik, LOC384050

MMRRC Submission

039991-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1978 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118554551-118620777 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118593132 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 598 (S598P)

Ref Sequence

ENSEMBL: ENSMUSP00000080592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]

Predicted Effect

probably benign
Transcript: ENSMUST00000071972
AA Change: S598P

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: S598P

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000081921
AA Change: S598P

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: S598P

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,537	C205*	probably null	Het
2810474O19Rik	T	A	6: 149,326,432	N325K	probably damaging	Het
4921539E11Rik	T	A	4: 103,270,764	T55S	possibly damaging	Het
Akap12	A	G	10: 4,313,855	D88G	probably benign	Het
Ankrd53	C	A	6: 83,763,203	F84L	probably damaging	Het
Apol7b	A	C	15: 77,423,339	F319V	probably damaging	Het
Bsn	A	G	9: 108,114,549	S1335P	probably benign	Het
Cep192	T	C	18: 67,803,158		probably null	Het
Commd8	T	C	5: 72,165,499	H25R	probably damaging	Het
Crisp4	T	C	1: 18,128,665	I143V	probably benign	Het
Cyp4a12b	A	T	4: 115,438,145	T483S	probably benign	Het
Dbx2	C	T	15: 95,632,353	M244I	probably damaging	Het
Dnah6	T	G	6: 73,121,970	H1982P	possibly damaging	Het
Fam220a	C	A	5: 143,563,127	P98Q	probably damaging	Het
Ggnbp1	A	G	17: 27,029,543	K29E	possibly damaging	Het
Gm14569	A	C	X: 36,432,128	M976R	probably benign	Het
Gm9573	T	A	17: 35,622,965		probably benign	Het
Hck	G	T	2: 153,129,856	W112C	probably damaging	Het
Heatr5a	A	T	12: 51,939,658	S591T	possibly damaging	Het
Hhat	A	G	1: 192,717,107	S242P	probably benign	Het
Hnrnpll	A	G	17: 80,044,518	S333P	probably benign	Het
Hoxc6	T	C	15: 103,010,007		probably null	Het
Inpp5j	G	A	11: 3,502,150	P367S	probably damaging	Het
Lamc2	A	G	1: 153,133,597		probably null	Het
Loxhd1	T	A	18: 77,321,642	I194N	possibly damaging	Het
Miga1	CCAGGGCAG	CCAG	3: 152,335,304		probably null	Het
Mkln1	C	T	6: 31,490,530	Q60*	probably null	Het
Mybph	C	A	1: 134,196,996	H185N	probably benign	Het
Myo1g	T	C	11: 6,520,829	D9G	possibly damaging	Het
Myo6	A	T	9: 80,228,925	D110V	probably damaging	Het
Ncoa7	A	G	10: 30,691,299	V412A	probably benign	Het
Neb	T	C	2: 52,287,345	K1328R	probably damaging	Het
Olfm5	T	A	7: 104,164,741	Q22L	unknown	Het
Olfr1106	C	T	2: 87,048,835	V134M	possibly damaging	Het
Olfr1328	A	T	4: 118,934,184	Y221*	probably null	Het
Olfr1355	A	G	10: 78,879,280	Y36C	probably damaging	Het
Olfr1414	C	A	1: 92,511,777	G84C	probably damaging	Het
Olfr1423	T	C	19: 12,036,341	T134A	probably benign	Het
Olfr414	T	A	1: 174,431,091	I221N	probably damaging	Het
P3h1	A	T	4: 119,247,976	Q717L	probably null	Het
Pclo	T	C	5: 14,713,795	I4094T	unknown	Het
Pfdn6	G	A	17: 33,939,077	R73W	probably benign	Het
Phyhipl	A	C	10: 70,559,761	M205R	possibly damaging	Het
Pitpnm1	C	T	19: 4,107,973		probably null	Het
Plcg1	A	G	2: 160,752,578		probably null	Het
Pnldc1	A	G	17: 12,906,505	S81P	possibly damaging	Het
Pno1	T	C	11: 17,204,519	I221V	possibly damaging	Het
Porcn	A	G	X: 8,204,301	V75A	probably damaging	Het
Prkcg	T	A	7: 3,305,346	C69S	probably damaging	Het
Rbbp6	G	T	7: 122,999,488		probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Scly	A	G	1: 91,320,169	D413G	probably damaging	Het
Scn11a	G	A	9: 119,780,795	R996*	probably null	Het
Slc6a13	A	T	6: 121,332,373	D281V	probably damaging	Het
Slfn5	T	C	11: 82,956,616	V109A	probably benign	Het
Smyd1	A	T	6: 71,312,719		probably null	Het
Snx29	T	A	16: 11,367,724	M57K	probably benign	Het
Stag1	T	G	9: 100,888,086	I603S	probably benign	Het
Svep1	C	A	4: 58,097,292	C1417F	possibly damaging	Het
Tbc1d23	T	C	16: 57,189,351	I392V	probably benign	Het
Tchh	T	C	3: 93,446,799	L1182P	unknown	Het
Tle3	T	A	9: 61,394,633	V108E	probably damaging	Het
Tmem144	T	C	3: 79,825,400		probably null	Het
Tpr	T	G	1: 150,419,907	L894V	possibly damaging	Het
Trappc9	A	T	15: 73,000,025	V472E	probably damaging	Het
Trim38	T	C	13: 23,791,098	V340A	probably damaging	Het
Ttc37	T	C	13: 76,134,815	V752A	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Vmn1r12	T	A	6: 57,159,509	I197N	possibly damaging	Het
Vmn1r26	T	C	6: 58,009,126	Y26C	possibly damaging	Het
Vwa3a	A	G	7: 120,758,954	I83V	probably null	Het
Xirp1	C	T	9: 120,018,591	E409K	probably benign	Het
Zc3h14	T	G	12: 98,763,922	I46R	probably damaging	Het
Zfp976	A	G	7: 42,613,841	C191R	probably damaging	Het

Other mutations in Cfap57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Cfap57	APN	4	118581001	missense	probably benign	0.01
IGL00508:Cfap57	APN	4	118581170	splice site	probably null
IGL00857:Cfap57	APN	4	118612923	critical splice donor site	probably null
IGL01147:Cfap57	APN	4	118589001	missense	probably damaging	0.97
IGL01396:Cfap57	APN	4	118610595	missense	probably damaging	1.00
IGL01420:Cfap57	APN	4	118612940	missense	probably benign	0.21
IGL01615:Cfap57	APN	4	118600796	missense	probably damaging	1.00
IGL02154:Cfap57	APN	4	118613017	missense	probably damaging	1.00
IGL02161:Cfap57	APN	4	118579372	missense	possibly damaging	0.75
IGL02481:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02483:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02503:Cfap57	APN	4	118569348	critical splice donor site	probably null
IGL02800:Cfap57	APN	4	118614750	missense	probably damaging	1.00
IGL03083:Cfap57	APN	4	118584739	missense	probably damaging	0.96
IGL03146:Cfap57	APN	4	118599019	missense	probably damaging	1.00
IGL03246:Cfap57	APN	4	118576645	missense	probably benign	0.29
IGL03376:Cfap57	APN	4	118584720	missense	probably damaging	0.96
R0144:Cfap57	UTSW	4	118584705	missense	probably damaging	1.00
R0184:Cfap57	UTSW	4	118599012	missense	probably damaging	1.00
R0415:Cfap57	UTSW	4	118569431	missense	possibly damaging	0.89
R0515:Cfap57	UTSW	4	118620402	missense	probably damaging	1.00
R0690:Cfap57	UTSW	4	118569727	splice site	probably benign
R0730:Cfap57	UTSW	4	118612920	splice site	probably null
R0737:Cfap57	UTSW	4	118581102	missense	possibly damaging	0.81
R0854:Cfap57	UTSW	4	118561872	missense	probably benign	0.04
R0880:Cfap57	UTSW	4	118581838	nonsense	probably null
R1085:Cfap57	UTSW	4	118595779	missense	probably benign	0.20
R1119:Cfap57	UTSW	4	118606676	nonsense	probably null
R1217:Cfap57	UTSW	4	118606652	missense	possibly damaging	0.67
R1294:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R1487:Cfap57	UTSW	4	118614781	missense	probably benign	0.01
R1676:Cfap57	UTSW	4	118595940	missense	probably damaging	1.00
R1688:Cfap57	UTSW	4	118569646	missense	probably null	0.20
R1709:Cfap57	UTSW	4	118571704	missense	probably benign	0.00
R1719:Cfap57	UTSW	4	118606631	missense	probably benign	0.04
R1782:Cfap57	UTSW	4	118614975	missense	probably damaging	0.98
R1791:Cfap57	UTSW	4	118571724	missense	possibly damaging	0.66
R1850:Cfap57	UTSW	4	118599894	missense	probably damaging	1.00
R1866:Cfap57	UTSW	4	118599927	missense	possibly damaging	0.49
R1912:Cfap57	UTSW	4	118615010	missense	probably damaging	0.96
R2177:Cfap57	UTSW	4	118606688	missense	probably benign	0.00
R2322:Cfap57	UTSW	4	118610725	missense	probably benign
R3905:Cfap57	UTSW	4	118595839	missense	probably damaging	1.00
R4013:Cfap57	UTSW	4	118593143	missense	probably benign	0.01
R4079:Cfap57	UTSW	4	118598997	missense	probably benign	0.34
R4962:Cfap57	UTSW	4	118613065	missense	probably benign	0.21
R4970:Cfap57	UTSW	4	118620371	missense	probably damaging	0.99
R4974:Cfap57	UTSW	4	118593054	missense	probably damaging	1.00
R4999:Cfap57	UTSW	4	118595848	missense	probably benign	0.01
R5482:Cfap57	UTSW	4	118569641	missense	probably benign
R5522:Cfap57	UTSW	4	118595888	missense	probably benign	0.41
R5626:Cfap57	UTSW	4	118614783	missense	probably damaging	1.00
R5685:Cfap57	UTSW	4	118569459	missense	probably benign
R5712:Cfap57	UTSW	4	118614795	missense	probably damaging	1.00
R5961:Cfap57	UTSW	4	118571745	missense	probably benign	0.00
R6244:Cfap57	UTSW	4	118579410	missense	probably damaging	0.99
R6268:Cfap57	UTSW	4	118569451	nonsense	probably null
R6271:Cfap57	UTSW	4	118595759	missense	probably benign	0.13
R6330:Cfap57	UTSW	4	118569396	missense	probably benign
R6439:Cfap57	UTSW	4	118588975	critical splice donor site	probably null
R6639:Cfap57	UTSW	4	118554712	missense	probably benign	0.13
R6722:Cfap57	UTSW	4	118584717	missense	probably damaging	1.00
R7033:Cfap57	UTSW	4	118613126	missense	possibly damaging	0.67
R7143:Cfap57	UTSW	4	118620709	unclassified	probably benign
R7162:Cfap57	UTSW	4	118614931	missense	probably benign
R7174:Cfap57	UTSW	4	118589067	missense	probably benign	0.35
R7210:Cfap57	UTSW	4	118576703	nonsense	probably null
R7242:Cfap57	UTSW	4	118593096	missense	possibly damaging	0.50
R7244:Cfap57	UTSW	4	118554800	nonsense	probably null
R7359:Cfap57	UTSW	4	118598965	missense	probably benign	0.01
R7373:Cfap57	UTSW	4	118614931	missense	probably benign
R7394:Cfap57	UTSW	4	118593137	missense	probably benign	0.00
R7401:Cfap57	UTSW	4	118614931	missense	probably benign
R7412:Cfap57	UTSW	4	118614931	missense	probably benign
R7414:Cfap57	UTSW	4	118614931	missense	probably benign
R7452:Cfap57	UTSW	4	118595784	missense	probably damaging	1.00
R7457:Cfap57	UTSW	4	118589001	missense	probably damaging	0.97
R7559:Cfap57	UTSW	4	118614931	missense	probably benign
R7642:Cfap57	UTSW	4	118614931	missense	probably benign
R7741:Cfap57	UTSW	4	118614931	missense	probably benign
R7744:Cfap57	UTSW	4	118614931	missense	probably benign
R7745:Cfap57	UTSW	4	118614931	missense	probably benign
R7842:Cfap57	UTSW	4	118554755	nonsense	probably null
R7936:Cfap57	UTSW	4	118614931	missense	probably benign
R7940:Cfap57	UTSW	4	118614931	missense	probably benign
R7942:Cfap57	UTSW	4	118614931	missense	probably benign
R8074:Cfap57	UTSW	4	118569625	missense	possibly damaging	0.66
R8301:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R8411:Cfap57	UTSW	4	118614931	missense	probably benign
R8447:Cfap57	UTSW	4	118614931	missense	probably benign
R8491:Cfap57	UTSW	4	118614931	missense	probably benign
R8524:Cfap57	UTSW	4	118614931	missense	probably benign
R8670:Cfap57	UTSW	4	118614925	missense	possibly damaging	0.91
R8707:Cfap57	UTSW	4	118593006	missense	probably benign	0.04
R8790:Cfap57	UTSW	4	118581914	missense	possibly damaging	0.59
X0022:Cfap57	UTSW	4	118614745	missense	probably benign
Z1088:Cfap57	UTSW	4	118581882	missense	probably benign	0.22
Z1177:Cfap57	UTSW	4	118598956	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TATGACTAGCCAGCAGGTGC -3'
(R):5'- TTCACATGCGGCTACTATACC -3'

Sequencing Primer
(F):5'- GCAACACAGAAACTGCTGG -3'
(R):5'- GCGGCTACTATACCAAATACTATAAG -3'

Posted On

2014-08-25