Incidental Mutation 'R1978:P3h1'
ID221976
Institutional Source Beutler Lab
Gene Symbol P3h1
Ensembl Gene ENSMUSG00000028641
Gene Nameprolyl 3-hydroxylase 1
SynonymsLepre1, Gros1, 2410024C15Rik
MMRRC Submission 039991-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1978 (G1)
Quality Score197
Status Not validated
Chromosome4
Chromosomal Location119232915-119248975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119247976 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 717 (Q717L)
Ref Sequence ENSEMBL: ENSMUSP00000112504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030393] [ENSMUST00000081606] [ENSMUST00000102662] [ENSMUST00000121111] [ENSMUST00000136278]
Predicted Effect probably null
Transcript: ENSMUST00000030393
AA Change: Q724L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030393
Gene: ENSMUSG00000028641
AA Change: Q724L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 60 84 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
internal_repeat_1 136 213 2.49e-12 PROSPERO
internal_repeat_1 294 369 2.49e-12 PROSPERO
Blast:P4Hc 419 462 2e-14 BLAST
P4Hc 479 687 5.96e-53 SMART
low complexity region 714 725 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000081606
AA Change: Q538L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080312
Gene: ENSMUSG00000028641
AA Change: Q538L

DomainStartEndE-ValueType
SCOP:d1hxia_ 80 195 4e-5 SMART
Blast:P4Hc 125 206 2e-11 BLAST
Blast:P4Hc 233 276 1e-14 BLAST
P4Hc 293 501 5.96e-53 SMART
low complexity region 528 539 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102662
AA Change: Q717L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099723
Gene: ENSMUSG00000028641
AA Change: Q717L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 60 84 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
internal_repeat_1 136 213 1.9e-12 PROSPERO
internal_repeat_1 294 369 1.9e-12 PROSPERO
Blast:P4Hc 412 455 2e-14 BLAST
P4Hc 472 680 5.96e-53 SMART
low complexity region 707 718 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121111
AA Change: Q717L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112504
Gene: ENSMUSG00000028641
AA Change: Q717L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 60 84 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
internal_repeat_1 136 213 2.32e-12 PROSPERO
internal_repeat_1 294 369 2.32e-12 PROSPERO
Blast:P4Hc 412 455 2e-14 BLAST
P4Hc 472 680 5.96e-53 SMART
low complexity region 707 718 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134548
Predicted Effect probably benign
Transcript: ENSMUST00000136278
SMART Domains Protein: ENSMUSP00000119695
Gene: ENSMUSG00000028641

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 60 84 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
internal_repeat_1 136 198 6.76e-13 PROSPERO
internal_repeat_1 294 356 6.76e-13 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153940
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that is a member of the collagen prolyl hydroxylase family. These enzymes are localized to the endoplasmic reticulum and their activity is required for proper collagen synthesis and assembly. Mutations in this gene are associated with osteogenesis imperfecta type VIII. Three alternatively spliced transcript variants encoding different isoforms have been described. Other variants may exist, but their biological validity has not been determined. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced size, disproportional reduction in long bone length, decreased bone density, decreased bone mineral density, reduced body fat, delayed ossification, and abnormal collagen networks in the skin and tendons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,537 C205* probably null Het
2810474O19Rik T A 6: 149,326,432 N325K probably damaging Het
4921539E11Rik T A 4: 103,270,764 T55S possibly damaging Het
Akap12 A G 10: 4,313,855 D88G probably benign Het
Ankrd53 C A 6: 83,763,203 F84L probably damaging Het
Apol7b A C 15: 77,423,339 F319V probably damaging Het
Bsn A G 9: 108,114,549 S1335P probably benign Het
Cep192 T C 18: 67,803,158 probably null Het
Cfap57 A G 4: 118,593,132 S598P probably benign Het
Commd8 T C 5: 72,165,499 H25R probably damaging Het
Crisp4 T C 1: 18,128,665 I143V probably benign Het
Cyp4a12b A T 4: 115,438,145 T483S probably benign Het
Dbx2 C T 15: 95,632,353 M244I probably damaging Het
Dnah6 T G 6: 73,121,970 H1982P possibly damaging Het
Fam220a C A 5: 143,563,127 P98Q probably damaging Het
Ggnbp1 A G 17: 27,029,543 K29E possibly damaging Het
Gm14569 A C X: 36,432,128 M976R probably benign Het
Gm9573 T A 17: 35,622,965 probably benign Het
Hck G T 2: 153,129,856 W112C probably damaging Het
Heatr5a A T 12: 51,939,658 S591T possibly damaging Het
Hhat A G 1: 192,717,107 S242P probably benign Het
Hnrnpll A G 17: 80,044,518 S333P probably benign Het
Hoxc6 T C 15: 103,010,007 probably null Het
Inpp5j G A 11: 3,502,150 P367S probably damaging Het
Lamc2 A G 1: 153,133,597 probably null Het
Loxhd1 T A 18: 77,321,642 I194N possibly damaging Het
Miga1 CCAGGGCAG CCAG 3: 152,335,304 probably null Het
Mkln1 C T 6: 31,490,530 Q60* probably null Het
Mybph C A 1: 134,196,996 H185N probably benign Het
Myo1g T C 11: 6,520,829 D9G possibly damaging Het
Myo6 A T 9: 80,228,925 D110V probably damaging Het
Ncoa7 A G 10: 30,691,299 V412A probably benign Het
Neb T C 2: 52,287,345 K1328R probably damaging Het
Olfm5 T A 7: 104,164,741 Q22L unknown Het
Olfr1106 C T 2: 87,048,835 V134M possibly damaging Het
Olfr1328 A T 4: 118,934,184 Y221* probably null Het
Olfr1355 A G 10: 78,879,280 Y36C probably damaging Het
Olfr1414 C A 1: 92,511,777 G84C probably damaging Het
Olfr1423 T C 19: 12,036,341 T134A probably benign Het
Olfr414 T A 1: 174,431,091 I221N probably damaging Het
Pclo T C 5: 14,713,795 I4094T unknown Het
Pfdn6 G A 17: 33,939,077 R73W probably benign Het
Phyhipl A C 10: 70,559,761 M205R possibly damaging Het
Pitpnm1 C T 19: 4,107,973 probably null Het
Plcg1 A G 2: 160,752,578 probably null Het
Pnldc1 A G 17: 12,906,505 S81P possibly damaging Het
Pno1 T C 11: 17,204,519 I221V possibly damaging Het
Porcn A G X: 8,204,301 V75A probably damaging Het
Prkcg T A 7: 3,305,346 C69S probably damaging Het
Rbbp6 G T 7: 122,999,488 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scly A G 1: 91,320,169 D413G probably damaging Het
Scn11a G A 9: 119,780,795 R996* probably null Het
Slc6a13 A T 6: 121,332,373 D281V probably damaging Het
Slfn5 T C 11: 82,956,616 V109A probably benign Het
Smyd1 A T 6: 71,312,719 probably null Het
Snx29 T A 16: 11,367,724 M57K probably benign Het
Stag1 T G 9: 100,888,086 I603S probably benign Het
Svep1 C A 4: 58,097,292 C1417F possibly damaging Het
Tbc1d23 T C 16: 57,189,351 I392V probably benign Het
Tchh T C 3: 93,446,799 L1182P unknown Het
Tle3 T A 9: 61,394,633 V108E probably damaging Het
Tmem144 T C 3: 79,825,400 probably null Het
Tpr T G 1: 150,419,907 L894V possibly damaging Het
Trappc9 A T 15: 73,000,025 V472E probably damaging Het
Trim38 T C 13: 23,791,098 V340A probably damaging Het
Ttc37 T C 13: 76,134,815 V752A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r12 T A 6: 57,159,509 I197N possibly damaging Het
Vmn1r26 T C 6: 58,009,126 Y26C possibly damaging Het
Vwa3a A G 7: 120,758,954 I83V probably null Het
Xirp1 C T 9: 120,018,591 E409K probably benign Het
Zc3h14 T G 12: 98,763,922 I46R probably damaging Het
Zfp976 A G 7: 42,613,841 C191R probably damaging Het
Other mutations in P3h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:P3h1 APN 4 119235283 missense probably damaging 1.00
IGL01623:P3h1 APN 4 119235283 missense probably damaging 1.00
IGL01645:P3h1 APN 4 119236783 missense probably damaging 1.00
IGL02140:P3h1 APN 4 119237865 missense probably damaging 1.00
IGL02415:P3h1 APN 4 119247955 missense probably benign
IGL02543:P3h1 APN 4 119237856 splice site probably benign
IGL02870:P3h1 APN 4 119247571 missense probably damaging 1.00
IGL02972:P3h1 APN 4 119247960 missense possibly damaging 0.75
IGL03067:P3h1 APN 4 119235280 missense probably damaging 0.99
IGL03077:P3h1 APN 4 119236786 missense probably damaging 1.00
woohoo UTSW 4 119241132 nonsense probably null
R0194:P3h1 UTSW 4 119237952 missense probably damaging 1.00
R0523:P3h1 UTSW 4 119241530 missense probably benign 0.32
R0734:P3h1 UTSW 4 119238688 missense probably damaging 1.00
R0944:P3h1 UTSW 4 119238759 missense probably benign 0.00
R1018:P3h1 UTSW 4 119237907 missense probably damaging 0.99
R2697:P3h1 UTSW 4 119247180 missense probably damaging 1.00
R5668:P3h1 UTSW 4 119244046 missense possibly damaging 0.89
R5750:P3h1 UTSW 4 119238666 missense probably damaging 0.96
R5965:P3h1 UTSW 4 119248227 missense probably benign 0.00
R5987:P3h1 UTSW 4 119246665 missense probably damaging 1.00
R6111:P3h1 UTSW 4 119241132 nonsense probably null
R6786:P3h1 UTSW 4 119237954 missense possibly damaging 0.65
R7142:P3h1 UTSW 4 119247161 missense probably benign 0.00
R8068:P3h1 UTSW 4 119236862 missense probably damaging 1.00
R8304:P3h1 UTSW 4 119247205 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACCATTGTTCTCTTGGAAGC -3'
(R):5'- AAGAGTGTGTCCTGCTATGCC -3'

Sequencing Primer
(F):5'- TTCTCTTGGAAGCGGCAGC -3'
(R):5'- CACCATGCAGAAGGCTGTG -3'
Posted On2014-08-25