Mutagenetix > Incidental Mutation

Incidental Mutation 'R2046:Ap2b1'

221999

Institutional Source

Beutler Lab

Gene Symbol

Ap2b1

Ensembl Gene

ENSMUSG00000035152

Gene Name

adaptor-related protein complex 2, beta 1 subunit

Synonyms

1300012O03Rik

MMRRC Submission

040053-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2046 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83299024-83405035 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 83336386 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 328 (Y328F)

Ref Sequence

ENSEMBL: ENSMUSP00000070714 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523] [ENSMUST00000176944]

AlphaFold

Q9DBG3

Predicted Effect

probably benign
Transcript: ENSMUST00000018875
AA Change: Y328F

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: Y328F

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	2.6e-173	PFAM
Pfam:HEAT_2	88	157	3.7e-8	PFAM
Pfam:Cnd1	99	268	2.1e-40	PFAM
Pfam:HEAT_2	124	219	1.4e-9	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	950	9.93e-56	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000065692
AA Change: Y328F

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: Y328F

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4.2e-173	PFAM
Pfam:HEAT_2	88	157	2.7e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
Alpha_adaptinC2	707	817	2.94e-18	SMART
B2-adapt-app_C	826	936	9.93e-56	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132178

Predicted Effect

probably benign
Transcript: ENSMUST00000176430
AA Change: Y328F

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: Y328F

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4e-173	PFAM
Pfam:HEAT_2	88	157	2.8e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	936	7.22e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000176523
AA Change: Y290F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152
AA Change: Y290F

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	95	1.1e-26	PFAM
Pfam:Cnd1	69	230	1.5e-26	PFAM
Pfam:HEAT_2	85	182	5.1e-9	PFAM
Pfam:Adaptin_N	90	496	4e-125	PFAM
low complexity region	587	605	N/A	INTRINSIC
low complexity region	616	637	N/A	INTRINSIC
Alpha_adaptinC2	683	793	2.94e-18	SMART
B2-adapt-app_C	802	912	9.93e-56	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000176944

SMART Domains

Protein: ENSMUSP00000134798
Gene: ENSMUSG00000035152

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	199	3.4e-67	PFAM
Pfam:DNA_alkylation	18	196	4.6e-8	PFAM
Pfam:HEAT_2	88	185	3.1e-13	PFAM
Pfam:Cnd1	99	198	4.2e-27	PFAM
Pfam:HEAT	122	151	1.4e-5	PFAM

Meta Mutation Damage Score

0.2569

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

97% (71/73)

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	T	A	2: 130,810,917	I42L	possibly damaging	Het
4930503L19Rik	T	A	18: 70,467,482	D84V	probably damaging	Het
Abcc5	A	T	16: 20,399,817	S272T	possibly damaging	Het
Adgre4	A	G	17: 55,778,847	N49D	possibly damaging	Het
Arhgef33	G	C	17: 80,373,466	E678D	probably benign	Het
Arid2	G	A	15: 96,369,387	V583I	probably damaging	Het
Bdkrb1	T	A	12: 105,604,726	S184T	probably benign	Het
Bend3	T	C	10: 43,511,846	F745S	probably damaging	Het
Card10	A	T	15: 78,787,473	V597E	possibly damaging	Het
Casp3	T	A	8: 46,629,726		probably benign	Het
Ccnb2	A	G	9: 70,409,347	V340A	probably benign	Het
Cdkl3	G	T	11: 52,026,850	V325L	probably benign	Het
Clec4n	T	A	6: 123,246,504	N153K	probably benign	Het
Crtac1	C	T	19: 42,334,053	V83I	probably damaging	Het
Cul9	C	A	17: 46,543,733	L14F	probably damaging	Het
Dgka	T	C	10: 128,723,535	Y519C	probably damaging	Het
Dhrs7	T	G	12: 72,652,266	K314T	possibly damaging	Het
Dnah10	G	T	5: 124,796,341	K2542N	probably benign	Het
Dock5	A	T	14: 67,812,142	V731E	probably benign	Het
Dpy19l1	T	A	9: 24,423,159	H571L	probably damaging	Het
Dzip1	A	T	14: 118,922,478	I106N	probably damaging	Het
Eif2ak4	A	T	2: 118,451,408		probably benign	Het
Epha4	T	C	1: 77,507,162	Y70C	probably damaging	Het
Eps15	T	C	4: 109,370,596	F344S	probably damaging	Het
Erbb4	C	T	1: 68,298,323	R612Q	probably benign	Het
Fam83h	T	C	15: 76,002,938	H850R	probably benign	Het
Fancg	A	G	4: 43,004,604	C484R	probably damaging	Het
Fzd9	A	G	5: 135,249,684	I449T	probably damaging	Het
Gm10647	A	G	9: 66,798,237		probably benign	Het
Gm4951	T	A	18: 60,245,499	H35Q	probably benign	Het
Itga11	C	T	9: 62,727,697	L86F	probably damaging	Het
Lamc2	C	T	1: 153,141,765	R492H	probably benign	Het
March6	A	G	15: 31,486,434	V325A	probably benign	Het
Myo5b	A	T	18: 74,577,455	I47F	probably benign	Het
Nek9	T	A	12: 85,320,707		probably benign	Het
Nelfb	T	A	2: 25,206,311	N262I	probably damaging	Het
Neurl4	A	G	11: 69,908,697	D942G	probably damaging	Het
Nipbl	G	A	15: 8,324,467	P1729S	probably benign	Het
Nr4a3	A	G	4: 48,067,807	T468A	possibly damaging	Het
Nrm	G	A	17: 35,864,217	V146I	probably benign	Het
Olfr1099	C	A	2: 86,958,733	A242S	possibly damaging	Het
Pitx3	T	C	19: 46,137,179	E42G	possibly damaging	Het
Pkd1l2	C	T	8: 116,999,955	A2271T	probably damaging	Het
Pofut2	A	G	10: 77,260,594	N51S	probably damaging	Het
Ppp1r3a	T	C	6: 14,722,104	E273G	probably benign	Het
Psme4	A	G	11: 30,817,723		probably benign	Het
Pus7l	T	C	15: 94,540,785	I60V	probably benign	Het
Pygo2	T	A	3: 89,433,148	N284K	possibly damaging	Het
Ralgapa1	C	T	12: 55,695,160	C1368Y	probably damaging	Het
Rbm45	G	A	2: 76,375,398	G198E	probably benign	Het
Reln	T	C	5: 21,942,627	I2442V	probably benign	Het
Rmi1	T	C	13: 58,407,958	V7A	probably benign	Het
Rsf1	T	C	7: 97,661,677	L538P	probably benign	Het
Rsph4a	T	G	10: 33,914,543		probably benign	Het
Sardh	A	T	2: 27,215,082	D676E	possibly damaging	Het
Sh3tc2	A	G	18: 61,990,843	M892V	probably benign	Het
Slc38a11	A	G	2: 65,358,185	F80S	probably damaging	Het
Slc6a2	C	A	8: 92,972,926	S194*	probably null	Het
Slco2b1	A	G	7: 99,690,479	F86L	probably damaging	Het
Smc3	G	A	19: 53,639,414	D875N	probably benign	Het
Sp100	G	A	1: 85,709,065	E575K	possibly damaging	Het
Spns2	A	G	11: 72,459,040	L196P	possibly damaging	Het
Taf8	A	G	17: 47,490,276	S261P	probably benign	Het
Trim2	A	G	3: 84,208,289	L86P	probably damaging	Het
Ttn	C	A	2: 76,907,794	V4134F	probably benign	Het
Ush2a	A	G	1: 188,356,927	T360A	probably benign	Het
Usp28	T	A	9: 49,039,075	C935S	probably damaging	Het
Vps37d	T	A	5: 135,073,977	M134L	probably benign	Het
Vwa2	T	G	19: 56,905,578	V329G	probably benign	Het
Zfp110	A	G	7: 12,849,422	R666G	probably benign	Het

Other mutations in Ap2b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00864:Ap2b1	APN	11	83333158	missense	probably damaging	0.99
IGL01583:Ap2b1	APN	11	83324611	missense	possibly damaging	0.61
IGL01753:Ap2b1	APN	11	83321973	missense	probably damaging	1.00
IGL01992:Ap2b1	APN	11	83335530	missense	probably damaging	1.00
IGL02192:Ap2b1	APN	11	83346766	missense	possibly damaging	0.48
IGL02315:Ap2b1	APN	11	83336799	missense	probably damaging	0.96
IGL03235:Ap2b1	APN	11	83341384	missense	probably benign	0.41
P0045:Ap2b1	UTSW	11	83368026	missense	probably damaging	1.00
R0121:Ap2b1	UTSW	11	83321967	missense	possibly damaging	0.66
R0334:Ap2b1	UTSW	11	83367874	splice site	probably benign
R1222:Ap2b1	UTSW	11	83346738	missense	probably benign	0.06
R1297:Ap2b1	UTSW	11	83333109	missense	probably damaging	1.00
R1653:Ap2b1	UTSW	11	83346831	missense	probably damaging	1.00
R1719:Ap2b1	UTSW	11	83324604	missense	probably damaging	1.00
R1885:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1886:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1965:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R1966:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R2086:Ap2b1	UTSW	11	83351118	missense	possibly damaging	0.88
R2132:Ap2b1	UTSW	11	83324761	splice site	probably benign
R3615:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3616:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3983:Ap2b1	UTSW	11	83390716	missense	probably damaging	1.00
R4124:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4125:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4198:Ap2b1	UTSW	11	83342603	missense	probably damaging	1.00
R4202:Ap2b1	UTSW	11	83335604	critical splice donor site	probably null
R4543:Ap2b1	UTSW	11	83324650	missense	probably damaging	1.00
R4583:Ap2b1	UTSW	11	83397779	missense	probably benign	0.00
R4589:Ap2b1	UTSW	11	83333011	nonsense	probably null
R4916:Ap2b1	UTSW	11	83390706	missense	probably damaging	1.00
R5005:Ap2b1	UTSW	11	83339392	missense	probably damaging	1.00
R5385:Ap2b1	UTSW	11	83342601	missense	probably damaging	1.00
R5510:Ap2b1	UTSW	11	83336737	splice site	probably null
R5738:Ap2b1	UTSW	11	83336430	splice site	probably null
R6023:Ap2b1	UTSW	11	83335398	missense	probably damaging	0.99
R6269:Ap2b1	UTSW	11	83346673	missense	probably damaging	1.00
R6383:Ap2b1	UTSW	11	83346825	missense	probably damaging	1.00
R6416:Ap2b1	UTSW	11	83308239	start codon destroyed	probably null	1.00
R6502:Ap2b1	UTSW	11	83342679	missense	probably damaging	0.97
R6810:Ap2b1	UTSW	11	83335491	missense	possibly damaging	0.89
R6969:Ap2b1	UTSW	11	83389726	missense	probably damaging	0.99
R7238:Ap2b1	UTSW	11	83333122	missense	possibly damaging	0.91
R7241:Ap2b1	UTSW	11	83351105	missense	probably benign	0.16
R7429:Ap2b1	UTSW	11	83367998	missense	probably benign	0.00
R7588:Ap2b1	UTSW	11	83324522	missense	probably benign	0.00
R7635:Ap2b1	UTSW	11	83389728	missense	probably benign	0.09
R7651:Ap2b1	UTSW	11	83339430	critical splice donor site	probably null
R7753:Ap2b1	UTSW	11	83367907	nonsense	probably null
R8468:Ap2b1	UTSW	11	83351065	missense	probably damaging	1.00
R8943:Ap2b1	UTSW	11	83346753	missense	probably damaging	1.00
R9093:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
R9621:Ap2b1	UTSW	11	83402598	missense	probably damaging	1.00
X0064:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
Z1177:Ap2b1	UTSW	11	83365753	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTACGAGGGTTTTCCGCCTG -3'
(R):5'- GTGGCATATTCCTTCAGCTCCG -3'

Sequencing Primer
(F):5'- TTTTCCGCCTGAAGAGGGC -3'
(R):5'- CTTTGGAAGAGAACTGAGCCATCTC -3'

Posted On

2014-08-25