Incidental Mutation 'R1978:Prkcg'
ID222004
Institutional Source Beutler Lab
Gene Symbol Prkcg
Ensembl Gene ENSMUSG00000078816
Gene Nameprotein kinase C, gamma
SynonymsPrkcc, PKCgamma, Pkcc
MMRRC Submission 039991-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1978 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location3289179-3331099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3305346 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 69 (C69S)
Ref Sequence ENSEMBL: ENSMUSP00000097874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100301] [ENSMUST00000172109] [ENSMUST00000203566]
Predicted Effect probably damaging
Transcript: ENSMUST00000100301
AA Change: C69S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097874
Gene: ENSMUSG00000078816
AA Change: C69S

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
C1 36 85 2.89e-16 SMART
C1 101 150 2.27e-14 SMART
C2 172 275 1.35e-26 SMART
low complexity region 319 331 N/A INTRINSIC
S_TKc 351 614 1.37e-94 SMART
S_TK_X 615 677 1.77e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172109
AA Change: C69S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131351
Gene: ENSMUSG00000078816
AA Change: C69S

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
C1 36 85 2.89e-16 SMART
C1 101 150 2.27e-14 SMART
C2 172 275 1.35e-26 SMART
S_TKc 309 563 2.73e-80 SMART
S_TK_X 564 626 1.77e-19 SMART
Predicted Effect unknown
Transcript: ENSMUST00000203081
AA Change: C1S
Predicted Effect probably benign
Transcript: ENSMUST00000203566
SMART Domains Protein: ENSMUSP00000145120
Gene: ENSMUSG00000068566

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:MARVEL 25 151 5.6e-16 PFAM
Pfam:MARVEL 162 311 1.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203600
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play distinct roles in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase is expressed solely in the brain and spinal cord and its localization is restricted to neurons. It has been demonstrated that several neuronal functions, including long term potentiation (LTP) and long term depression (LTD), specifically require this kinase. Knockout studies in mice also suggest that this kinase may be involved in neuropathic pain development. Defects in this protein have been associated with neurodegenerative disorder spinocerebellar ataxia-14 (SCA14). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Depending upon genetic background, homozygous null mice show mild deficits in spatial learning and contextual conditioning. Genotype-dependent reductions in sensitivity to the effects of ethanol on righting reflex and hypothermia, in neuropathic pain after injury, and in anxiety are also evident. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,537 C205* probably null Het
2810474O19Rik T A 6: 149,326,432 N325K probably damaging Het
4921539E11Rik T A 4: 103,270,764 T55S possibly damaging Het
Akap12 A G 10: 4,313,855 D88G probably benign Het
Ankrd53 C A 6: 83,763,203 F84L probably damaging Het
Apol7b A C 15: 77,423,339 F319V probably damaging Het
Bsn A G 9: 108,114,549 S1335P probably benign Het
Cep192 T C 18: 67,803,158 probably null Het
Cfap57 A G 4: 118,593,132 S598P probably benign Het
Commd8 T C 5: 72,165,499 H25R probably damaging Het
Crisp4 T C 1: 18,128,665 I143V probably benign Het
Cyp4a12b A T 4: 115,438,145 T483S probably benign Het
Dbx2 C T 15: 95,632,353 M244I probably damaging Het
Dnah6 T G 6: 73,121,970 H1982P possibly damaging Het
Fam220a C A 5: 143,563,127 P98Q probably damaging Het
Ggnbp1 A G 17: 27,029,543 K29E possibly damaging Het
Gm14569 A C X: 36,432,128 M976R probably benign Het
Gm9573 T A 17: 35,622,965 probably benign Het
Hck G T 2: 153,129,856 W112C probably damaging Het
Heatr5a A T 12: 51,939,658 S591T possibly damaging Het
Hhat A G 1: 192,717,107 S242P probably benign Het
Hnrnpll A G 17: 80,044,518 S333P probably benign Het
Hoxc6 T C 15: 103,010,007 probably null Het
Inpp5j G A 11: 3,502,150 P367S probably damaging Het
Lamc2 A G 1: 153,133,597 probably null Het
Loxhd1 T A 18: 77,321,642 I194N possibly damaging Het
Miga1 CCAGGGCAG CCAG 3: 152,335,304 probably null Het
Mkln1 C T 6: 31,490,530 Q60* probably null Het
Mybph C A 1: 134,196,996 H185N probably benign Het
Myo1g T C 11: 6,520,829 D9G possibly damaging Het
Myo6 A T 9: 80,228,925 D110V probably damaging Het
Ncoa7 A G 10: 30,691,299 V412A probably benign Het
Neb T C 2: 52,287,345 K1328R probably damaging Het
Olfm5 T A 7: 104,164,741 Q22L unknown Het
Olfr1106 C T 2: 87,048,835 V134M possibly damaging Het
Olfr1328 A T 4: 118,934,184 Y221* probably null Het
Olfr1355 A G 10: 78,879,280 Y36C probably damaging Het
Olfr1414 C A 1: 92,511,777 G84C probably damaging Het
Olfr1423 T C 19: 12,036,341 T134A probably benign Het
Olfr414 T A 1: 174,431,091 I221N probably damaging Het
P3h1 A T 4: 119,247,976 Q717L probably null Het
Pclo T C 5: 14,713,795 I4094T unknown Het
Pfdn6 G A 17: 33,939,077 R73W probably benign Het
Phyhipl A C 10: 70,559,761 M205R possibly damaging Het
Pitpnm1 C T 19: 4,107,973 probably null Het
Plcg1 A G 2: 160,752,578 probably null Het
Pnldc1 A G 17: 12,906,505 S81P possibly damaging Het
Pno1 T C 11: 17,204,519 I221V possibly damaging Het
Porcn A G X: 8,204,301 V75A probably damaging Het
Rbbp6 G T 7: 122,999,488 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scly A G 1: 91,320,169 D413G probably damaging Het
Scn11a G A 9: 119,780,795 R996* probably null Het
Slc6a13 A T 6: 121,332,373 D281V probably damaging Het
Slfn5 T C 11: 82,956,616 V109A probably benign Het
Smyd1 A T 6: 71,312,719 probably null Het
Snx29 T A 16: 11,367,724 M57K probably benign Het
Stag1 T G 9: 100,888,086 I603S probably benign Het
Svep1 C A 4: 58,097,292 C1417F possibly damaging Het
Tbc1d23 T C 16: 57,189,351 I392V probably benign Het
Tchh T C 3: 93,446,799 L1182P unknown Het
Tle3 T A 9: 61,394,633 V108E probably damaging Het
Tmem144 T C 3: 79,825,400 probably null Het
Tpr T G 1: 150,419,907 L894V possibly damaging Het
Trappc9 A T 15: 73,000,025 V472E probably damaging Het
Trim38 T C 13: 23,791,098 V340A probably damaging Het
Ttc37 T C 13: 76,134,815 V752A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r12 T A 6: 57,159,509 I197N possibly damaging Het
Vmn1r26 T C 6: 58,009,126 Y26C possibly damaging Het
Vwa3a A G 7: 120,758,954 I83V probably null Het
Xirp1 C T 9: 120,018,591 E409K probably benign Het
Zc3h14 T G 12: 98,763,922 I46R probably damaging Het
Zfp976 A G 7: 42,613,841 C191R probably damaging Het
Other mutations in Prkcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Prkcg APN 7 3319619 missense probably benign 0.27
IGL01551:Prkcg APN 7 3303826 unclassified probably benign
IGL02167:Prkcg APN 7 3322581 critical splice donor site probably null
IGL02434:Prkcg APN 7 3318890 missense probably benign
R0044:Prkcg UTSW 7 3315001 intron probably benign
R0164:Prkcg UTSW 7 3329119 missense probably damaging 1.00
R0164:Prkcg UTSW 7 3329119 missense probably damaging 1.00
R0413:Prkcg UTSW 7 3319579 missense probably benign 0.00
R0417:Prkcg UTSW 7 3304304 critical splice acceptor site probably null
R1113:Prkcg UTSW 7 3329106 missense probably damaging 1.00
R1170:Prkcg UTSW 7 3319661 missense probably damaging 0.97
R1308:Prkcg UTSW 7 3329106 missense probably damaging 1.00
R1634:Prkcg UTSW 7 3323470 missense probably damaging 1.00
R2016:Prkcg UTSW 7 3323550 missense probably damaging 0.98
R2209:Prkcg UTSW 7 3303581 unclassified probably benign
R3788:Prkcg UTSW 7 3313747 missense probably damaging 0.99
R4006:Prkcg UTSW 7 3327467 missense probably damaging 0.96
R4853:Prkcg UTSW 7 3318953 missense probably damaging 0.99
R4915:Prkcg UTSW 7 3330265 nonsense probably null
R4916:Prkcg UTSW 7 3330265 nonsense probably null
R4997:Prkcg UTSW 7 3322581 critical splice donor site probably null
R5446:Prkcg UTSW 7 3330264 missense probably benign 0.00
R5646:Prkcg UTSW 7 3329081 missense probably damaging 0.97
R5677:Prkcg UTSW 7 3323458 missense probably damaging 1.00
R6913:Prkcg UTSW 7 3313819 missense probably benign 0.02
R7355:Prkcg UTSW 7 3323509 missense possibly damaging 0.94
R7371:Prkcg UTSW 7 3319553 missense probably benign 0.27
R7544:Prkcg UTSW 7 3310565 missense probably benign 0.00
R7649:Prkcg UTSW 7 3329964 missense probably benign 0.09
R7742:Prkcg UTSW 7 3329943 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TACAGCTCTTGGTCTGGGTC -3'
(R):5'- AAGGAATCTGGGCCAGACTG -3'

Sequencing Primer
(F):5'- GGTCTGGGTCTCTCCTCTG -3'
(R):5'- CCAGACTGGGCTCTTTCTATC -3'
Posted On2014-08-25