Incidental Mutation 'R1978:Rbbp6'
ID222014
Institutional Source Beutler Lab
Gene Symbol Rbbp6
Ensembl Gene ENSMUSG00000030779
Gene Nameretinoblastoma binding protein 6, ubiquitin ligase
SynonymsC030034J04Rik, 4933422O15Rik
MMRRC Submission 039991-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1978 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location122965686-123002557 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 122999488 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052135] [ENSMUST00000071590] [ENSMUST00000205495] [ENSMUST00000231323]
Predicted Effect unknown
Transcript: ENSMUST00000052135
AA Change: K1007N
SMART Domains Protein: ENSMUSP00000049528
Gene: ENSMUSG00000030779
AA Change: K1007N

DomainStartEndE-ValueType
DWNN 4 76 3.92e-42 SMART
low complexity region 101 110 N/A INTRINSIC
ZnF_C2HC 161 177 5.67e-5 SMART
low complexity region 233 259 N/A INTRINSIC
RING 260 300 6.05e-4 SMART
low complexity region 338 349 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 474 485 N/A INTRINSIC
low complexity region 551 610 N/A INTRINSIC
coiled coil region 653 679 N/A INTRINSIC
low complexity region 680 774 N/A INTRINSIC
low complexity region 824 844 N/A INTRINSIC
low complexity region 929 943 N/A INTRINSIC
low complexity region 1003 1025 N/A INTRINSIC
internal_repeat_2 1026 1091 4.38e-6 PROSPERO
internal_repeat_1 1038 1107 3.76e-7 PROSPERO
low complexity region 1120 1141 N/A INTRINSIC
low complexity region 1143 1154 N/A INTRINSIC
low complexity region 1247 1258 N/A INTRINSIC
internal_repeat_2 1395 1466 4.38e-6 PROSPERO
low complexity region 1472 1490 N/A INTRINSIC
internal_repeat_1 1523 1586 3.76e-7 PROSPERO
low complexity region 1689 1752 N/A INTRINSIC
low complexity region 1758 1784 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000071590
AA Change: K973N
SMART Domains Protein: ENSMUSP00000071519
Gene: ENSMUSG00000030779
AA Change: K973N

DomainStartEndE-ValueType
DWNN 4 76 3.92e-42 SMART
low complexity region 101 110 N/A INTRINSIC
ZnF_C2HC 161 177 5.67e-5 SMART
low complexity region 233 259 N/A INTRINSIC
RING 260 300 6.05e-4 SMART
low complexity region 338 349 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 474 485 N/A INTRINSIC
low complexity region 551 610 N/A INTRINSIC
low complexity region 653 740 N/A INTRINSIC
low complexity region 790 810 N/A INTRINSIC
low complexity region 895 909 N/A INTRINSIC
low complexity region 969 991 N/A INTRINSIC
internal_repeat_2 992 1057 5.65e-6 PROSPERO
internal_repeat_1 1004 1073 5.01e-7 PROSPERO
low complexity region 1086 1107 N/A INTRINSIC
low complexity region 1109 1120 N/A INTRINSIC
low complexity region 1213 1224 N/A INTRINSIC
internal_repeat_2 1361 1432 5.65e-6 PROSPERO
low complexity region 1438 1456 N/A INTRINSIC
internal_repeat_1 1489 1552 5.01e-7 PROSPERO
low complexity region 1655 1718 N/A INTRINSIC
low complexity region 1724 1750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206967
Predicted Effect unknown
Transcript: ENSMUST00000231323
AA Change: K1045N
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The retinoblastoma tumor suppressor (pRB) protein binds with many other proteins. In various human cancers, pRB suppresses cellular proliferation and is inactivated. Cell cycle-dependent phosphorylation regulates the activity of pRB. This gene encodes a protein which binds to underphosphorylated but not phosphorylated pRB. Multiple alternatively spliced transcript variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality, reduced size, growth retardation and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,537 C205* probably null Het
2810474O19Rik T A 6: 149,326,432 N325K probably damaging Het
4921539E11Rik T A 4: 103,270,764 T55S possibly damaging Het
Akap12 A G 10: 4,313,855 D88G probably benign Het
Ankrd53 C A 6: 83,763,203 F84L probably damaging Het
Apol7b A C 15: 77,423,339 F319V probably damaging Het
Bsn A G 9: 108,114,549 S1335P probably benign Het
Cep192 T C 18: 67,803,158 probably null Het
Cfap57 A G 4: 118,593,132 S598P probably benign Het
Commd8 T C 5: 72,165,499 H25R probably damaging Het
Crisp4 T C 1: 18,128,665 I143V probably benign Het
Cyp4a12b A T 4: 115,438,145 T483S probably benign Het
Dbx2 C T 15: 95,632,353 M244I probably damaging Het
Dnah6 T G 6: 73,121,970 H1982P possibly damaging Het
Fam220a C A 5: 143,563,127 P98Q probably damaging Het
Ggnbp1 A G 17: 27,029,543 K29E possibly damaging Het
Gm14569 A C X: 36,432,128 M976R probably benign Het
Gm9573 T A 17: 35,622,965 probably benign Het
Hck G T 2: 153,129,856 W112C probably damaging Het
Heatr5a A T 12: 51,939,658 S591T possibly damaging Het
Hhat A G 1: 192,717,107 S242P probably benign Het
Hnrnpll A G 17: 80,044,518 S333P probably benign Het
Hoxc6 T C 15: 103,010,007 probably null Het
Inpp5j G A 11: 3,502,150 P367S probably damaging Het
Lamc2 A G 1: 153,133,597 probably null Het
Loxhd1 T A 18: 77,321,642 I194N possibly damaging Het
Miga1 CCAGGGCAG CCAG 3: 152,335,304 probably null Het
Mkln1 C T 6: 31,490,530 Q60* probably null Het
Mybph C A 1: 134,196,996 H185N probably benign Het
Myo1g T C 11: 6,520,829 D9G possibly damaging Het
Myo6 A T 9: 80,228,925 D110V probably damaging Het
Ncoa7 A G 10: 30,691,299 V412A probably benign Het
Neb T C 2: 52,287,345 K1328R probably damaging Het
Olfm5 T A 7: 104,164,741 Q22L unknown Het
Olfr1106 C T 2: 87,048,835 V134M possibly damaging Het
Olfr1328 A T 4: 118,934,184 Y221* probably null Het
Olfr1355 A G 10: 78,879,280 Y36C probably damaging Het
Olfr1414 C A 1: 92,511,777 G84C probably damaging Het
Olfr1423 T C 19: 12,036,341 T134A probably benign Het
Olfr414 T A 1: 174,431,091 I221N probably damaging Het
P3h1 A T 4: 119,247,976 Q717L probably null Het
Pclo T C 5: 14,713,795 I4094T unknown Het
Pfdn6 G A 17: 33,939,077 R73W probably benign Het
Phyhipl A C 10: 70,559,761 M205R possibly damaging Het
Pitpnm1 C T 19: 4,107,973 probably null Het
Plcg1 A G 2: 160,752,578 probably null Het
Pnldc1 A G 17: 12,906,505 S81P possibly damaging Het
Pno1 T C 11: 17,204,519 I221V possibly damaging Het
Porcn A G X: 8,204,301 V75A probably damaging Het
Prkcg T A 7: 3,305,346 C69S probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scly A G 1: 91,320,169 D413G probably damaging Het
Scn11a G A 9: 119,780,795 R996* probably null Het
Slc6a13 A T 6: 121,332,373 D281V probably damaging Het
Slfn5 T C 11: 82,956,616 V109A probably benign Het
Smyd1 A T 6: 71,312,719 probably null Het
Snx29 T A 16: 11,367,724 M57K probably benign Het
Stag1 T G 9: 100,888,086 I603S probably benign Het
Svep1 C A 4: 58,097,292 C1417F possibly damaging Het
Tbc1d23 T C 16: 57,189,351 I392V probably benign Het
Tchh T C 3: 93,446,799 L1182P unknown Het
Tle3 T A 9: 61,394,633 V108E probably damaging Het
Tmem144 T C 3: 79,825,400 probably null Het
Tpr T G 1: 150,419,907 L894V possibly damaging Het
Trappc9 A T 15: 73,000,025 V472E probably damaging Het
Trim38 T C 13: 23,791,098 V340A probably damaging Het
Ttc37 T C 13: 76,134,815 V752A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r12 T A 6: 57,159,509 I197N possibly damaging Het
Vmn1r26 T C 6: 58,009,126 Y26C possibly damaging Het
Vwa3a A G 7: 120,758,954 I83V probably null Het
Xirp1 C T 9: 120,018,591 E409K probably benign Het
Zc3h14 T G 12: 98,763,922 I46R probably damaging Het
Zfp976 A G 7: 42,613,841 C191R probably damaging Het
Other mutations in Rbbp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Rbbp6 APN 7 122988685 missense probably damaging 1.00
IGL00561:Rbbp6 APN 7 122971063 missense probably damaging 1.00
IGL01144:Rbbp6 APN 7 122975946 missense possibly damaging 0.95
IGL01325:Rbbp6 APN 7 122988618 missense probably damaging 1.00
IGL01520:Rbbp6 APN 7 122985675 missense possibly damaging 0.93
IGL01765:Rbbp6 APN 7 122999954 unclassified probably benign
IGL01985:Rbbp6 APN 7 122971073 missense probably damaging 1.00
IGL02094:Rbbp6 APN 7 122997262 missense probably damaging 1.00
IGL02125:Rbbp6 APN 7 122971129 critical splice donor site probably null
IGL02552:Rbbp6 APN 7 122982981 missense probably damaging 0.98
IGL02805:Rbbp6 APN 7 123001188 utr 3 prime probably benign
changeling UTSW 7 122997311 splice site probably null
Puzzlewit UTSW 7 122999808 unclassified probably benign
R0403:Rbbp6 UTSW 7 122992296 missense probably damaging 0.99
R0855:Rbbp6 UTSW 7 122992248 missense probably benign 0.22
R1132:Rbbp6 UTSW 7 123000113 unclassified probably benign
R1463:Rbbp6 UTSW 7 122992453 missense possibly damaging 0.89
R1867:Rbbp6 UTSW 7 122997029 missense probably damaging 1.00
R1957:Rbbp6 UTSW 7 122990288 missense probably benign 0.04
R1958:Rbbp6 UTSW 7 123001945 unclassified probably benign
R1999:Rbbp6 UTSW 7 122990352 missense probably damaging 0.98
R2164:Rbbp6 UTSW 7 122999474 unclassified probably benign
R4181:Rbbp6 UTSW 7 122994735 missense probably damaging 0.99
R4387:Rbbp6 UTSW 7 122997311 splice site probably null
R4583:Rbbp6 UTSW 7 123001952 unclassified probably benign
R4936:Rbbp6 UTSW 7 122999703 unclassified probably benign
R4974:Rbbp6 UTSW 7 122999808 unclassified probably benign
R4998:Rbbp6 UTSW 7 122990326 missense probably benign 0.36
R5082:Rbbp6 UTSW 7 123000702 utr 3 prime probably benign
R5502:Rbbp6 UTSW 7 122988724 missense probably damaging 1.00
R5567:Rbbp6 UTSW 7 123001834 utr 3 prime probably benign
R5570:Rbbp6 UTSW 7 123001834 utr 3 prime probably benign
R5607:Rbbp6 UTSW 7 122997086 missense probably damaging 1.00
R5608:Rbbp6 UTSW 7 122997086 missense probably damaging 1.00
R5948:Rbbp6 UTSW 7 122997628 missense probably damaging 1.00
R6134:Rbbp6 UTSW 7 122997311 splice site probably null
R6172:Rbbp6 UTSW 7 122998555 nonsense probably null
R6773:Rbbp6 UTSW 7 122999355 unclassified probably benign
R6800:Rbbp6 UTSW 7 122985064 missense possibly damaging 0.93
R7266:Rbbp6 UTSW 7 123001367 missense unknown
R7298:Rbbp6 UTSW 7 123001194 missense unknown
R7535:Rbbp6 UTSW 7 122990143 missense probably benign 0.00
R7635:Rbbp6 UTSW 7 122976008 missense possibly damaging 0.80
R7665:Rbbp6 UTSW 7 122994686 missense possibly damaging 0.81
R7665:Rbbp6 UTSW 7 122990032 splice site probably null
R7910:Rbbp6 UTSW 7 122997028 missense possibly damaging 0.48
R7956:Rbbp6 UTSW 7 123001338 missense unknown
R8043:Rbbp6 UTSW 7 122985245 missense probably damaging 1.00
R8273:Rbbp6 UTSW 7 122990324 missense probably benign 0.36
R8473:Rbbp6 UTSW 7 123001198 utr 3 prime probably benign
X0062:Rbbp6 UTSW 7 123000146 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCCTGAACCCAGAGCTACTG -3'
(R):5'- CATCCTTCTGAGAAGACGAGGAAG -3'

Sequencing Primer
(F):5'- CTACTGGAGACGTCTAGGAAATGC -3'
(R):5'- ACAGAGTCAATCTTTGTAGCCTC -3'
Posted On2014-08-25