Mutagenetix > Incidental Mutation

Incidental Mutation 'R1978:Stag1'

222024

Institutional Source

Beutler Lab

Gene Symbol

Stag1

Ensembl Gene

ENSMUSG00000037286

Gene Name

stromal antigen 1

Synonyms

Scc3, SA-1

MMRRC Submission

039991-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1978 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

100597798-100959375 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 100888086 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 603 (I603S)

Ref Sequence

ENSEMBL: ENSMUSP00000116205 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041418] [ENSMUST00000123302] [ENSMUST00000129269] [ENSMUST00000155108]

AlphaFold

Q9D3E6

Predicted Effect

probably benign
Transcript: ENSMUST00000041418
AA Change: I603S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000040724
Gene: ENSMUSG00000037286
AA Change: I603S

Domain	Start	End	E-Value	Type
low complexity region	32	44	N/A	INTRINSIC
low complexity region	59	72	N/A	INTRINSIC
Pfam:STAG	157	276	1.5e-50	PFAM
SCOP:d1qbkb_	279	850	4e-5	SMART
low complexity region	1062	1081	N/A	INTRINSIC
low complexity region	1107	1120	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000123302

SMART Domains

Protein: ENSMUSP00000117879
Gene: ENSMUSG00000037286

Domain	Start	End	E-Value	Type
low complexity region	32	44	N/A	INTRINSIC
low complexity region	59	72	N/A	INTRINSIC
Pfam:STAG	157	276	2.9e-51	PFAM
low complexity region	303	315	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129269
AA Change: I603S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000116205
Gene: ENSMUSG00000037286
AA Change: I603S

Domain	Start	End	E-Value	Type
low complexity region	32	44	N/A	INTRINSIC
low complexity region	59	72	N/A	INTRINSIC
Pfam:STAG	160	274	3.8e-41	PFAM
SCOP:d1qbkb_	279	850	3e-5	SMART
low complexity region	1062	1081	N/A	INTRINSIC
low complexity region	1107	1120	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000143955

SMART Domains

Protein: ENSMUSP00000115460
Gene: ENSMUSG00000037286

Domain	Start	End	E-Value	Type
low complexity region	232	251	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000146934
AA Change: I213S

SMART Domains

Protein: ENSMUSP00000120974
Gene: ENSMUSG00000037286
AA Change: I213S

Domain	Start	End	E-Value	Type
low complexity region	673	692	N/A	INTRINSIC
low complexity region	718	731	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149771

Predicted Effect

probably benign
Transcript: ENSMUST00000155108

SMART Domains

Protein: ENSMUSP00000118952
Gene: ENSMUSG00000037286

Domain	Start	End	E-Value	Type
low complexity region	32	44	N/A	INTRINSIC
low complexity region	59	72	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the SCC3 family and is expressed in the nucleus. It encodes a component of cohesin, a multisubunit protein complex that provides sister chromatid cohesion along the length of a chromosome from DNA replication through prophase and prometaphase, after which it is dissociated in preparation for segregation during anaphase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mouse embryos homozygous for a null mutation show developmental delay and die before birth. Heterozygous animals have shorter lifespan and earlier onset of tumourigenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,537	C205*	probably null	Het
2810474O19Rik	T	A	6: 149,326,432	N325K	probably benign	Het
4921539E11Rik	T	A	4: 103,270,764	T55S	possibly damaging	Het
Akap12	A	G	10: 4,313,855	D88G	probably benign	Het
Ankrd53	C	A	6: 83,763,203	F84L	probably damaging	Het
Apol7b	A	C	15: 77,423,339	F319V	probably damaging	Het
Bsn	A	G	9: 108,114,549	S1335P	probably benign	Het
Cep192	T	C	18: 67,803,158		probably null	Het
Cfap57	A	G	4: 118,593,132	S598P	probably benign	Het
Commd8	T	C	5: 72,165,499	H25R	probably damaging	Het
Crisp4	T	C	1: 18,128,665	I143V	probably benign	Het
Cyp4a12b	A	T	4: 115,438,145	T483S	probably benign	Het
Dbx2	C	T	15: 95,632,353	M244I	probably damaging	Het
Dnah6	T	G	6: 73,121,970	H1982P	possibly damaging	Het
Fam220a	C	A	5: 143,563,127	P98Q	probably damaging	Het
Ggnbp1	A	G	17: 27,029,543	K29E	possibly damaging	Het
Gm14569	A	C	X: 36,432,128	M976R	probably benign	Het
Gm9573	T	A	17: 35,622,965		probably benign	Het
Hck	G	T	2: 153,129,856	W112C	probably damaging	Het
Heatr5a	A	T	12: 51,939,658	S591T	possibly damaging	Het
Hhat	A	G	1: 192,717,107	S242P	probably benign	Het
Hnrnpll	A	G	17: 80,044,518	S333P	probably benign	Het
Hoxc6	T	C	15: 103,010,007		probably null	Het
Inpp5j	G	A	11: 3,502,150	P367S	probably damaging	Het
Lamc2	A	G	1: 153,133,597		probably null	Het
Loxhd1	T	A	18: 77,321,642	I194N	possibly damaging	Het
Miga1	CCAGGGCAG	CCAG	3: 152,335,304		probably null	Het
Mkln1	C	T	6: 31,490,530	Q60*	probably null	Het
Mybph	C	A	1: 134,196,996	H185N	probably benign	Het
Myo1g	T	C	11: 6,520,829	D9G	possibly damaging	Het
Myo6	A	T	9: 80,228,925	D110V	probably damaging	Het
Ncoa7	A	G	10: 30,691,299	V412A	probably benign	Het
Neb	T	C	2: 52,287,345	K1328R	probably damaging	Het
Olfm5	T	A	7: 104,164,741	Q22L	unknown	Het
Olfr1106	C	T	2: 87,048,835	V134M	possibly damaging	Het
Olfr1328	A	T	4: 118,934,184	Y221*	probably null	Het
Olfr1355	A	G	10: 78,879,280	Y36C	probably damaging	Het
Olfr1414	C	A	1: 92,511,777	G84C	probably damaging	Het
Olfr1423	T	C	19: 12,036,341	T134A	probably benign	Het
Olfr414	T	A	1: 174,431,091	I221N	probably damaging	Het
P3h1	A	T	4: 119,247,976	Q717L	probably null	Het
Pclo	T	C	5: 14,713,795	I4094T	unknown	Het
Pfdn6	G	A	17: 33,939,077	R73W	probably benign	Het
Phyhipl	A	C	10: 70,559,761	M205R	possibly damaging	Het
Pitpnm1	C	T	19: 4,107,973		probably null	Het
Plcg1	A	G	2: 160,752,578		probably null	Het
Pnldc1	A	G	17: 12,906,505	S81P	possibly damaging	Het
Pno1	T	C	11: 17,204,519	I221V	possibly damaging	Het
Porcn	A	G	X: 8,204,301	V75A	probably damaging	Het
Prkcg	T	A	7: 3,305,346	C69S	probably damaging	Het
Rbbp6	G	T	7: 122,999,488		probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Scly	A	G	1: 91,320,169	D413G	probably damaging	Het
Scn11a	G	A	9: 119,780,795	R996*	probably null	Het
Slc6a13	A	T	6: 121,332,373	D281V	probably damaging	Het
Slfn5	T	C	11: 82,956,616	V109A	probably benign	Het
Smyd1	A	T	6: 71,312,719		probably null	Het
Snx29	T	A	16: 11,367,724	M57K	probably benign	Het
Svep1	C	A	4: 58,097,292	C1417F	possibly damaging	Het
Tbc1d23	T	C	16: 57,189,351	I392V	probably benign	Het
Tchh	T	C	3: 93,446,799	L1182P	unknown	Het
Tle3	T	A	9: 61,394,633	V108E	probably damaging	Het
Tmem144	T	C	3: 79,825,400		probably null	Het
Tpr	T	G	1: 150,419,907	L894V	possibly damaging	Het
Trappc9	A	T	15: 73,000,025	V472E	probably damaging	Het
Trim38	T	C	13: 23,791,098	V340A	probably damaging	Het
Ttc37	T	C	13: 76,134,815	V752A	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Vmn1r12	T	A	6: 57,159,509	I197N	possibly damaging	Het
Vmn1r26	T	C	6: 58,009,126	Y26C	possibly damaging	Het
Vwa3a	A	G	7: 120,758,954	I83V	probably null	Het
Xirp1	C	T	9: 120,018,591	E409K	probably benign	Het
Zc3h14	T	G	12: 98,763,922	I46R	probably damaging	Het
Zfp976	A	G	7: 42,613,841	C191R	probably damaging	Het

Other mutations in Stag1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00649:Stag1	APN	9	100776808	missense	probably damaging	1.00
IGL01010:Stag1	APN	9	100945933	missense	probably benign	0.06
IGL01012:Stag1	APN	9	100855859	missense	possibly damaging	0.47
IGL01025:Stag1	APN	9	100951657	missense	possibly damaging	0.95
IGL01307:Stag1	APN	9	100951788	intron	probably benign
IGL02149:Stag1	APN	9	100887389	missense	probably benign	0.09
IGL02608:Stag1	APN	9	100757769	missense	probably null	0.99
IGL03008:Stag1	APN	9	100776791	missense	probably damaging	1.00
IGL03210:Stag1	APN	9	100845076	missense	possibly damaging	0.63
eto_o	UTSW	9	100796716	missense	probably damaging	1.00
PIT4280001:Stag1	UTSW	9	100942716	missense	possibly damaging	0.95
R0070:Stag1	UTSW	9	100956408	missense	probably null	1.00
R0070:Stag1	UTSW	9	100956408	missense	probably null	1.00
R0349:Stag1	UTSW	9	100776784	missense	probably damaging	0.98
R0479:Stag1	UTSW	9	100928091	missense	probably benign	0.00
R0531:Stag1	UTSW	9	100954247	makesense	probably null
R0962:Stag1	UTSW	9	100796827	missense	probably damaging	1.00
R0976:Stag1	UTSW	9	100776824	missense	probably damaging	0.98
R0976:Stag1	UTSW	9	100930016	critical splice donor site	probably null
R1170:Stag1	UTSW	9	100888453	intron	probably benign
R1499:Stag1	UTSW	9	100855832	missense	possibly damaging	0.77
R1499:Stag1	UTSW	9	100887373	intron	probably benign
R1644:Stag1	UTSW	9	100880900	intron	probably benign
R1747:Stag1	UTSW	9	100888300	missense	probably benign
R1799:Stag1	UTSW	9	100953462	splice site	probably null
R1807:Stag1	UTSW	9	100908666	missense	probably benign	0.34
R2029:Stag1	UTSW	9	100786687	missense	probably damaging	1.00
R2161:Stag1	UTSW	9	100889595	missense	probably damaging	1.00
R2300:Stag1	UTSW	9	100712500	missense	possibly damaging	0.92
R2327:Stag1	UTSW	9	100786613	missense	possibly damaging	0.81
R2426:Stag1	UTSW	9	100845116	critical splice donor site	probably null
R2448:Stag1	UTSW	9	100888409	missense	probably benign	0.42
R2504:Stag1	UTSW	9	100866210	missense	probably damaging	0.99
R3713:Stag1	UTSW	9	100889618	missense	probably benign	0.01
R3835:Stag1	UTSW	9	100737982	missense	probably damaging	0.97
R3862:Stag1	UTSW	9	100944785	missense	probably benign	0.02
R4398:Stag1	UTSW	9	100956606	utr 3 prime	probably benign
R4568:Stag1	UTSW	9	100848669	missense	probably damaging	1.00
R4651:Stag1	UTSW	9	100796716	missense	probably damaging	1.00
R4652:Stag1	UTSW	9	100796716	missense	probably damaging	1.00
R4653:Stag1	UTSW	9	100796716	missense	probably damaging	1.00
R4675:Stag1	UTSW	9	100848705	missense	probably damaging	1.00
R4709:Stag1	UTSW	9	100738039	missense	probably damaging	0.99
R4924:Stag1	UTSW	9	100796755	missense	possibly damaging	0.67
R5018:Stag1	UTSW	9	100951619	missense	probably benign	0.00
R5435:Stag1	UTSW	9	100953550	missense	probably benign	0.03
R5460:Stag1	UTSW	9	100956453	splice site	probably null
R5805:Stag1	UTSW	9	100796778	missense	probably damaging	1.00
R6127:Stag1	UTSW	9	100951697	missense	probably benign	0.05
R6313:Stag1	UTSW	9	100757733	missense	probably damaging	1.00
R6597:Stag1	UTSW	9	100887420	missense	probably benign	0.01
R6807:Stag1	UTSW	9	100944850	missense	probably damaging	1.00
R7099:Stag1	UTSW	9	100944826	missense	probably benign	0.02
R7167:Stag1	UTSW	9	100945889	missense	probably benign	0.05
R7395:Stag1	UTSW	9	100796728	missense	probably damaging	0.99
R7504:Stag1	UTSW	9	100888328	missense	probably benign	0.09
R7663:Stag1	UTSW	9	100738138	missense	probably damaging	0.98
R7769:Stag1	UTSW	9	100944827	missense	possibly damaging	0.86
R8245:Stag1	UTSW	9	100929893	missense	probably benign	0.01
R8343:Stag1	UTSW	9	100757766	missense	possibly damaging	0.95
R8473:Stag1	UTSW	9	100880787	missense	probably damaging	1.00
R8709:Stag1	UTSW	9	100890922	intron	probably benign
R8925:Stag1	UTSW	9	100705245	missense	possibly damaging	0.46
R8927:Stag1	UTSW	9	100705245	missense	possibly damaging	0.46
R8951:Stag1	UTSW	9	100880801	missense	probably damaging	1.00
R9138:Stag1	UTSW	9	100947282	missense	probably benign	0.01
R9233:Stag1	UTSW	9	100929971	missense	probably benign	0.00
R9246:Stag1	UTSW	9	100888276	missense	probably benign	0.00
R9419:Stag1	UTSW	9	100929914	missense	probably benign
R9442:Stag1	UTSW	9	100954253	missense	probably damaging	1.00
R9694:Stag1	UTSW	9	100928098	missense	probably benign	0.05
R9740:Stag1	UTSW	9	100705235	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCTAGGTGCTAACAGCCAAAGAAAG -3'
(R):5'- AAGCATCCAGGTGCTGAAGG -3'

Sequencing Primer
(F):5'- GGAAAACTCAAATTGATGATAGGAAC -3'
(R):5'- CATCAGTTGTTGACTAACCTA -3'

Posted On

2014-08-25