Mutagenetix > Incidental Mutation

Incidental Mutation 'R1978:Bsn'

222026

Institutional Source

Beutler Lab

Gene Symbol

Bsn

Ensembl Gene

ENSMUSG00000032589

Gene Name

bassoon

Synonyms

presynaptic cytomatrix protein

MMRRC Submission

039991-MU

Accession Numbers

Genbank: NM_007567; MGI: 1277955

Essential gene?

Possibly non essential (E-score: 0.383) question?

Stock #

R1978 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108096022-108190384 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 108114549 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1335 (S1335P)

Ref Sequence

ENSEMBL: ENSMUSP00000035208 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035208]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000035208
AA Change: S1335P

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: S1335P

Domain	Start	End	E-Value	Type
low complexity region	4	40	N/A	INTRINSIC
low complexity region	42	77	N/A	INTRINSIC
Pfam:zf-piccolo	165	223	6.1e-30	PFAM
low complexity region	394	409	N/A	INTRINSIC
low complexity region	445	454	N/A	INTRINSIC
Pfam:zf-piccolo	462	520	5.2e-31	PFAM
low complexity region	527	540	N/A	INTRINSIC
low complexity region	627	643	N/A	INTRINSIC
low complexity region	664	681	N/A	INTRINSIC
low complexity region	694	708	N/A	INTRINSIC
low complexity region	788	803	N/A	INTRINSIC
low complexity region	994	1021	N/A	INTRINSIC
coiled coil region	1047	1101	N/A	INTRINSIC
low complexity region	1131	1145	N/A	INTRINSIC
low complexity region	1173	1190	N/A	INTRINSIC
low complexity region	1209	1220	N/A	INTRINSIC
low complexity region	1333	1343	N/A	INTRINSIC
low complexity region	1443	1455	N/A	INTRINSIC
low complexity region	1481	1498	N/A	INTRINSIC
low complexity region	1790	1800	N/A	INTRINSIC
low complexity region	2117	2126	N/A	INTRINSIC
low complexity region	2287	2303	N/A	INTRINSIC
low complexity region	2326	2356	N/A	INTRINSIC
SCOP:d1eq1a_	2362	2477	2e-7	SMART
low complexity region	2607	2614	N/A	INTRINSIC
low complexity region	2635	2651	N/A	INTRINSIC
low complexity region	2655	2672	N/A	INTRINSIC
coiled coil region	2949	2990	N/A	INTRINSIC
low complexity region	3057	3071	N/A	INTRINSIC
low complexity region	3089	3114	N/A	INTRINSIC
low complexity region	3446	3461	N/A	INTRINSIC
low complexity region	3520	3534	N/A	INTRINSIC
low complexity region	3653	3666	N/A	INTRINSIC
low complexity region	3750	3820	N/A	INTRINSIC
low complexity region	3831	3852	N/A	INTRINSIC
low complexity region	3856	3901	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124763

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,537	C205*	probably null	Het
2810474O19Rik	T	A	6: 149,326,432	N325K	probably benign	Het
4921539E11Rik	T	A	4: 103,270,764	T55S	possibly damaging	Het
Akap12	A	G	10: 4,313,855	D88G	probably benign	Het
Ankrd53	C	A	6: 83,763,203	F84L	probably damaging	Het
Apol7b	A	C	15: 77,423,339	F319V	probably damaging	Het
Cep192	T	C	18: 67,803,158		probably null	Het
Cfap57	A	G	4: 118,593,132	S598P	probably benign	Het
Commd8	T	C	5: 72,165,499	H25R	probably damaging	Het
Crisp4	T	C	1: 18,128,665	I143V	probably benign	Het
Cyp4a12b	A	T	4: 115,438,145	T483S	probably benign	Het
Dbx2	C	T	15: 95,632,353	M244I	probably damaging	Het
Dnah6	T	G	6: 73,121,970	H1982P	possibly damaging	Het
Fam220a	C	A	5: 143,563,127	P98Q	probably damaging	Het
Ggnbp1	A	G	17: 27,029,543	K29E	possibly damaging	Het
Gm14569	A	C	X: 36,432,128	M976R	probably benign	Het
Gm9573	T	A	17: 35,622,965		probably benign	Het
Hck	G	T	2: 153,129,856	W112C	probably damaging	Het
Heatr5a	A	T	12: 51,939,658	S591T	possibly damaging	Het
Hhat	A	G	1: 192,717,107	S242P	probably benign	Het
Hnrnpll	A	G	17: 80,044,518	S333P	probably benign	Het
Hoxc6	T	C	15: 103,010,007		probably null	Het
Inpp5j	G	A	11: 3,502,150	P367S	probably damaging	Het
Lamc2	A	G	1: 153,133,597		probably null	Het
Loxhd1	T	A	18: 77,321,642	I194N	possibly damaging	Het
Miga1	CCAGGGCAG	CCAG	3: 152,335,304		probably null	Het
Mkln1	C	T	6: 31,490,530	Q60*	probably null	Het
Mybph	C	A	1: 134,196,996	H185N	probably benign	Het
Myo1g	T	C	11: 6,520,829	D9G	possibly damaging	Het
Myo6	A	T	9: 80,228,925	D110V	probably damaging	Het
Ncoa7	A	G	10: 30,691,299	V412A	probably benign	Het
Neb	T	C	2: 52,287,345	K1328R	probably damaging	Het
Olfm5	T	A	7: 104,164,741	Q22L	unknown	Het
Olfr1106	C	T	2: 87,048,835	V134M	possibly damaging	Het
Olfr1328	A	T	4: 118,934,184	Y221*	probably null	Het
Olfr1355	A	G	10: 78,879,280	Y36C	probably damaging	Het
Olfr1414	C	A	1: 92,511,777	G84C	probably damaging	Het
Olfr1423	T	C	19: 12,036,341	T134A	probably benign	Het
Olfr414	T	A	1: 174,431,091	I221N	probably damaging	Het
P3h1	A	T	4: 119,247,976	Q717L	probably null	Het
Pclo	T	C	5: 14,713,795	I4094T	unknown	Het
Pfdn6	G	A	17: 33,939,077	R73W	probably benign	Het
Phyhipl	A	C	10: 70,559,761	M205R	possibly damaging	Het
Pitpnm1	C	T	19: 4,107,973		probably null	Het
Plcg1	A	G	2: 160,752,578		probably null	Het
Pnldc1	A	G	17: 12,906,505	S81P	possibly damaging	Het
Pno1	T	C	11: 17,204,519	I221V	possibly damaging	Het
Porcn	A	G	X: 8,204,301	V75A	probably damaging	Het
Prkcg	T	A	7: 3,305,346	C69S	probably damaging	Het
Rbbp6	G	T	7: 122,999,488		probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Scly	A	G	1: 91,320,169	D413G	probably damaging	Het
Scn11a	G	A	9: 119,780,795	R996*	probably null	Het
Slc6a13	A	T	6: 121,332,373	D281V	probably damaging	Het
Slfn5	T	C	11: 82,956,616	V109A	probably benign	Het
Smyd1	A	T	6: 71,312,719		probably null	Het
Snx29	T	A	16: 11,367,724	M57K	probably benign	Het
Stag1	T	G	9: 100,888,086	I603S	probably benign	Het
Svep1	C	A	4: 58,097,292	C1417F	possibly damaging	Het
Tbc1d23	T	C	16: 57,189,351	I392V	probably benign	Het
Tchh	T	C	3: 93,446,799	L1182P	unknown	Het
Tle3	T	A	9: 61,394,633	V108E	probably damaging	Het
Tmem144	T	C	3: 79,825,400		probably null	Het
Tpr	T	G	1: 150,419,907	L894V	possibly damaging	Het
Trappc9	A	T	15: 73,000,025	V472E	probably damaging	Het
Trim38	T	C	13: 23,791,098	V340A	probably damaging	Het
Ttc37	T	C	13: 76,134,815	V752A	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Vmn1r12	T	A	6: 57,159,509	I197N	possibly damaging	Het
Vmn1r26	T	C	6: 58,009,126	Y26C	possibly damaging	Het
Vwa3a	A	G	7: 120,758,954	I83V	probably null	Het
Xirp1	C	T	9: 120,018,591	E409K	probably benign	Het
Zc3h14	T	G	12: 98,763,922	I46R	probably damaging	Het
Zfp976	A	G	7: 42,613,841	C191R	probably damaging	Het

Other mutations in Bsn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Bsn	APN	9	108115110	missense	probably benign	0.01
IGL00330:Bsn	APN	9	108115340	missense	probably damaging	1.00
IGL00863:Bsn	APN	9	108115322	missense	probably damaging	1.00
IGL01123:Bsn	APN	9	108115986	missense	probably damaging	1.00
IGL01330:Bsn	APN	9	108110913	unclassified	probably benign
IGL01336:Bsn	APN	9	108111785	missense	probably damaging	0.99
IGL01399:Bsn	APN	9	108107187	missense	unknown
IGL01683:Bsn	APN	9	108114896	missense	possibly damaging	0.71
IGL02022:Bsn	APN	9	108110418	unclassified	probably benign
IGL02396:Bsn	APN	9	108116046	missense	possibly damaging	0.90
IGL02538:Bsn	APN	9	108105236	missense	unknown
IGL02565:Bsn	APN	9	108113288	missense	probably damaging	0.99
IGL02661:Bsn	APN	9	108106936	nonsense	probably null
IGL02739:Bsn	APN	9	108112546	missense	probably benign	0.14
IGL02951:Bsn	APN	9	108115613	missense	probably damaging	1.00
IGL02987:Bsn	APN	9	108126304	missense	probably benign	0.03
IGL03033:Bsn	APN	9	108115993	missense	probably damaging	1.00
IGL03069:Bsn	APN	9	108114263	missense	probably damaging	1.00
IGL03076:Bsn	APN	9	108105382	missense	unknown
R0068:Bsn	UTSW	9	108112137	missense	probably damaging	1.00
R0068:Bsn	UTSW	9	108112137	missense	probably damaging	1.00
R0167:Bsn	UTSW	9	108125986	missense	probably benign	0.01
R0234:Bsn	UTSW	9	108116396	missense	possibly damaging	0.50
R0234:Bsn	UTSW	9	108116396	missense	possibly damaging	0.50
R0359:Bsn	UTSW	9	108111846	missense	possibly damaging	0.81
R0514:Bsn	UTSW	9	108125782	missense	probably benign	0.07
R0593:Bsn	UTSW	9	108110306	missense	unknown
R0617:Bsn	UTSW	9	108107240	missense	unknown
R0636:Bsn	UTSW	9	108107834	missense	unknown
R0652:Bsn	UTSW	9	108105742	missense	unknown
R0718:Bsn	UTSW	9	108111360	unclassified	probably benign
R0730:Bsn	UTSW	9	108106812	missense	unknown
R0905:Bsn	UTSW	9	108105635	missense	unknown
R0963:Bsn	UTSW	9	108111807	missense	possibly damaging	0.81
R0992:Bsn	UTSW	9	108114354	nonsense	probably null
R1101:Bsn	UTSW	9	108116411	missense	probably damaging	1.00
R1393:Bsn	UTSW	9	108110517	unclassified	probably benign
R1490:Bsn	UTSW	9	108113994	missense	probably benign	0.03
R1566:Bsn	UTSW	9	108125985	missense	probably benign	0.35
R1582:Bsn	UTSW	9	108105092	missense	unknown
R1738:Bsn	UTSW	9	108106934	missense	unknown
R1867:Bsn	UTSW	9	108106719	missense	unknown
R1918:Bsn	UTSW	9	108107573	missense	unknown
R1933:Bsn	UTSW	9	108116444	missense	possibly damaging	0.91
R1946:Bsn	UTSW	9	108114651	missense	probably damaging	0.99
R2068:Bsn	UTSW	9	108110684	unclassified	probably benign
R2068:Bsn	UTSW	9	108126550	missense	possibly damaging	0.95
R2113:Bsn	UTSW	9	108114886	missense	probably benign	0.14
R2136:Bsn	UTSW	9	108113231	missense	probably damaging	1.00
R2172:Bsn	UTSW	9	108109992	intron	probably benign
R2266:Bsn	UTSW	9	108115124	missense	probably damaging	1.00
R2293:Bsn	UTSW	9	108113067	missense	possibly damaging	0.47
R2294:Bsn	UTSW	9	108113067	missense	possibly damaging	0.47
R2368:Bsn	UTSW	9	108111030	nonsense	probably null
R2442:Bsn	UTSW	9	108106920	missense	unknown
R2507:Bsn	UTSW	9	108116114	missense	probably damaging	1.00
R2880:Bsn	UTSW	9	108113067	missense	possibly damaging	0.47
R2881:Bsn	UTSW	9	108113067	missense	possibly damaging	0.47
R2922:Bsn	UTSW	9	108108186	missense	unknown
R2922:Bsn	UTSW	9	108115469	missense	probably damaging	1.00
R3618:Bsn	UTSW	9	108117561	critical splice acceptor site	probably null
R3742:Bsn	UTSW	9	108105739	missense	unknown
R3825:Bsn	UTSW	9	108106856	missense	unknown
R3982:Bsn	UTSW	9	108107166	missense	unknown
R4094:Bsn	UTSW	9	108113870	missense	probably damaging	1.00
R4158:Bsn	UTSW	9	108112946	missense	possibly damaging	0.95
R4225:Bsn	UTSW	9	108106733	missense	unknown
R4261:Bsn	UTSW	9	108110684	unclassified	probably benign
R4482:Bsn	UTSW	9	108114664	missense	probably damaging	1.00
R4515:Bsn	UTSW	9	108104078	splice site	probably null
R4585:Bsn	UTSW	9	108110463	unclassified	probably benign
R4628:Bsn	UTSW	9	108113235	missense	probably damaging	1.00
R4636:Bsn	UTSW	9	108115424	missense	probably damaging	1.00
R4679:Bsn	UTSW	9	108110130	missense	unknown
R4723:Bsn	UTSW	9	108112655	missense	probably benign	0.03
R4843:Bsn	UTSW	9	108107189	missense	unknown
R4885:Bsn	UTSW	9	108107527	nonsense	probably null
R4936:Bsn	UTSW	9	108111761	missense	probably damaging	1.00
R4942:Bsn	UTSW	9	108106479	missense	unknown
R4972:Bsn	UTSW	9	108115178	missense	probably damaging	1.00
R4992:Bsn	UTSW	9	108115548	missense	probably damaging	1.00
R5067:Bsn	UTSW	9	108111953	missense	probably damaging	1.00
R5206:Bsn	UTSW	9	108105373	missense	unknown
R5286:Bsn	UTSW	9	108110924	unclassified	probably benign
R5492:Bsn	UTSW	9	108112515	missense	probably damaging	0.98
R5553:Bsn	UTSW	9	108110421	unclassified	probably benign
R5561:Bsn	UTSW	9	108105511	missense	unknown
R5597:Bsn	UTSW	9	108114932	missense	probably benign	0.06
R5646:Bsn	UTSW	9	108110432	unclassified	probably benign
R5796:Bsn	UTSW	9	108126024	missense	probably damaging	1.00
R5801:Bsn	UTSW	9	108113009	missense	possibly damaging	0.81
R5802:Bsn	UTSW	9	108113009	missense	possibly damaging	0.81
R5850:Bsn	UTSW	9	108114950	missense	probably damaging	0.99
R5938:Bsn	UTSW	9	108113009	missense	possibly damaging	0.81
R6221:Bsn	UTSW	9	108105566	missense	unknown
R6243:Bsn	UTSW	9	108107561	missense	unknown
R6254:Bsn	UTSW	9	108111866	missense	probably damaging	0.96
R6263:Bsn	UTSW	9	108113254	missense	probably damaging	1.00
R6345:Bsn	UTSW	9	108107355	missense	unknown
R6368:Bsn	UTSW	9	108111314	unclassified	probably benign
R6574:Bsn	UTSW	9	108113954	missense	possibly damaging	0.95
R6793:Bsn	UTSW	9	108114615	nonsense	probably null
R6802:Bsn	UTSW	9	108110624	unclassified	probably benign
R6943:Bsn	UTSW	9	108107817	missense	unknown
R6999:Bsn	UTSW	9	108113433	missense	probably benign	0.00
R7149:Bsn	UTSW	9	108116321	nonsense	probably null
R7199:Bsn	UTSW	9	108115334	missense	probably damaging	1.00
R7322:Bsn	UTSW	9	108126421	nonsense	probably null
R7349:Bsn	UTSW	9	108110783	missense	unknown
R7372:Bsn	UTSW	9	108110519	missense	unknown
R7373:Bsn	UTSW	9	108113484	missense	probably damaging	1.00
R7413:Bsn	UTSW	9	108139491	missense	possibly damaging	0.61
R7473:Bsn	UTSW	9	108112250	missense	probably damaging	1.00
R7482:Bsn	UTSW	9	108113529	missense	probably damaging	0.98
R7530:Bsn	UTSW	9	108111956	missense	probably damaging	1.00
R7549:Bsn	UTSW	9	108114815	missense	probably benign	0.05
R7570:Bsn	UTSW	9	108113543	missense	probably damaging	1.00
R7635:Bsn	UTSW	9	108110990	missense	unknown
R7696:Bsn	UTSW	9	108114501	missense	probably damaging	1.00
R7757:Bsn	UTSW	9	108114740	missense	possibly damaging	0.90
R7868:Bsn	UTSW	9	108114899	missense	possibly damaging	0.95
R7897:Bsn	UTSW	9	108111866	missense	probably damaging	0.98
R7960:Bsn	UTSW	9	108115548	missense	probably damaging	1.00
R8022:Bsn	UTSW	9	108114404	missense	probably benign	0.01
R8056:Bsn	UTSW	9	108105307	missense
R8158:Bsn	UTSW	9	108110033	missense	unknown
R8161:Bsn	UTSW	9	108139530	missense	probably benign	0.20
R8225:Bsn	UTSW	9	108107106	missense
R8282:Bsn	UTSW	9	108107691	missense	possibly damaging	0.73
R8296:Bsn	UTSW	9	108117379	missense	probably benign	0.00
R8415:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8417:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8426:Bsn	UTSW	9	108126573	missense	probably damaging	1.00
R8437:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8438:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8439:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8440:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8441:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8442:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8513:Bsn	UTSW	9	108114510	missense	possibly damaging	0.65
R8529:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8535:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8546:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8548:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8549:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8682:Bsn	UTSW	9	108106169	missense
R8773:Bsn	UTSW	9	108110505	missense	unknown
R8883:Bsn	UTSW	9	108113028	missense	probably damaging	0.98
R8906:Bsn	UTSW	9	108107553	missense	unknown
R9018:Bsn	UTSW	9	108117289	missense	probably benign	0.06
R9070:Bsn	UTSW	9	108110096	missense
R9094:Bsn	UTSW	9	108110853	missense	unknown
R9098:Bsn	UTSW	9	108112974	missense	possibly damaging	0.65
R9128:Bsn	UTSW	9	108116150	missense	probably benign	0.21
R9162:Bsn	UTSW	9	108110684	missense	unknown
R9224:Bsn	UTSW	9	108105487	missense
R9230:Bsn	UTSW	9	108112260	missense	probably damaging	1.00
R9233:Bsn	UTSW	9	108117090	missense	probably benign	0.28
R9245:Bsn	UTSW	9	108116093	missense	probably damaging	1.00
R9275:Bsn	UTSW	9	108111620	missense	probably damaging	1.00
R9307:Bsn	UTSW	9	108115794	missense	probably benign	0.01
R9343:Bsn	UTSW	9	108115502	missense	probably damaging	1.00
R9377:Bsn	UTSW	9	108113601	missense	probably damaging	1.00
R9377:Bsn	UTSW	9	108116162	missense	probably damaging	1.00
R9378:Bsn	UTSW	9	108107655	missense	possibly damaging	0.85
R9408:Bsn	UTSW	9	108139453	nonsense	probably null
R9455:Bsn	UTSW	9	108111332	missense	unknown
R9563:Bsn	UTSW	9	108107417	missense
R9615:Bsn	UTSW	9	108107231	missense
R9656:Bsn	UTSW	9	108117208	missense	probably benign	0.09
R9698:Bsn	UTSW	9	108115971	missense	probably damaging	1.00
X0028:Bsn	UTSW	9	108113504	missense	probably damaging	1.00
X0066:Bsn	UTSW	9	108139210	missense	probably damaging	1.00
Z1177:Bsn	UTSW	9	108105499	missense
Z1177:Bsn	UTSW	9	108139195	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TATACCCTCGTGTCGGACTG -3'
(R):5'- GGAGATCCTTCAGACATCCCAG -3'

Sequencing Primer
(F):5'- CTGTGGTGGCTGGTGACCC -3'
(R):5'- CAGAGCATAGCCCGGATG -3'

Posted On

2014-08-25